Ido1 (NM_001293690) Mouse Untagged Clone

CAT#: MC226989

Ido1 (untagged) - Mouse indoleamine 2,3-dioxygenase 1 (Ido1), transcript variant 2



  "NM_001293690" in other vectors (1)

CNY 3140.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Mouse monoclonal anti-IDO1 antibody
    • 100 ug

CNY 8303.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Ido; Indo
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226989 representing NM_001293690
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGTATGTGTGGAACCGAGGGGATGACGATGTTCGAAAGGTGCTGCCCCGCAATATTGCTGTTCCCT
ACTGCGAGCTCTCAGAGAAGTTGGGCCTGCCTCCTATTCTGTCTTATGCAGACTGTGTCCTGGCAAACTG
GAAGAAAAAGGACCCCAATGGGCCCATGACATACGAGAACATGGACATTCTGTTCTCATTTCCTGGTGGG
GACTGCGACAAGGGCTTCTTCCTCGTCTCTCTATTGGTGGAAATCGCAGCTTCTCCTGCAATCAAAGCAA
TCCCCACTGTATCCAGTGCAGTAGAGCGTCAAGACCTGAAAGCATTGGAAAAGGCACTGCACGACATAGC
TACCAGTCTGGAGAAAGCCAAGGAAATTTTTAAGAGGATGCGTGACTTTGTGGACCCAGACACGTTTTTC
CACGTTCTCCGCATATATCTGTCTGGCTGGAAATGCAGCTCCAAGCTGCCAGAAGGTCTGCTGTATGAGG
GGGTCTGGGACACCCCAAAAATGTTTTCAGGGGGCAGTGCAGGCCAGAGCAGCATCTTCCAGAGTCTTGA
TGTCCTTCTGGGAATAAAACACGAGGCTGGCAAAGAATCTCCTGCAGAATTCCTCCAGGAAATGAGAGAG
TACATGCCTCCAGCCCACCGGAACTTCCTTTTCTTCTTAGAGTCAGCTCCCCCAGTCCGTGAGTTTGTCA
TTTCAAGACACAATGAAGACTTGACGAAAGCTTATAACGAGTGTGTGAATGGTCTGGTCTCTGTGAGAAA
GTTCCACCTCGCAATAGTAGATACTTACATTATGAAACCTTCGAAGAAGAAGCCCACTGATGGCGACAAG
TCGGAAGAGCCCTCAAATGTGGAAAGCAGAGGGACTGGGGGTACGAATCCCATGACTTTCCTAAGGAGTG
TGAAAGATACAACCGAGAAAGCTCTTCTGAGTTGGCCTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001293690
Insert Size 951 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001293690.1, NP_001280619.1
RefSeq Size 1659 bp
RefSeq ORF 951 bp
Locus ID 15930
UniProt ID P28776
Gene Summary Catalyzes the first and rate limiting step of the catabolism of the essential amino acid tryptophan along the kynurenine pathway. Involved in the peripheral immune tolerance, contributing to maintain homeostasis by preventing autoimmunity or immunopathology that would result from uncontrolled and overreacting immune responses. Tryptophan shortage inhibits T lymphocytes division and accumulation of tryptophan catabolites induces T-cell apoptosis and differentiation of regulatory T-cells. Acts as a suppressor of anti-tumor immunity (PubMed:25691885). Limits the growth of intracellular pathogens by depriving tryptophan. Protects the fetus from maternal immune rejection (Ref. 3).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) contains an alternate exon in place of the first exon compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...