Cd1d2 (NM_001289449) Mouse Untagged Clone

CAT#: MC226885

Cd1d2 (untagged) - Mouse CD1d2 antigen (Cd1d2), transcript variant 2



  "NM_001289449" in other vectors (1)

CNY 2950.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms CD1.2; Cd1b; Ly-38
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226885 representing NM_001289449
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCGGTACCTACCGTGCCTGTTGCTGTGGGCATTCCTACAGGTCTGGGGACAATCTGAAGTCCAGCAAA
AGAATTACACCTTCCGCTGCCTGCAGACTTCTTCCTTTGCTAACATAAGCTGGTCCCGCACAGACAGCCT
GATCTTGCTGGGGGATCTGCAGACACACCGTTGGAGTAATGACTCAGCCATCATCAGCTTCACGAAGCCA
TGGTCCCAGGATCCCATTGAGATCCAGTTGTCTACCGGCTGTGAAATGTACCCTGGGAATGCTTCGGAAA
GCTTTTTTCATGTAGCATTTCAAGGAAAATATGCCGTGAGATTCCGGGGAACATCTTGGCAGAGGGTCCT
AGGGGCCCCATCTTGGTTAGACTTGCCCATCAAAGTGCTCAACGCTGATCAAGGGACAAGTGCAACCGTG
CAGACGCTCCTGAATGACACCTGGCCCCAGTTTGCCCGTGGTCTCCTAGAGGCAGGGAAGTCAGACCTAG
AGAAGCAAGAGAAGCCAGTGGCCTGGTTGTCCAGTGTCCCCAGCTCTGCACATGGCCATCTGCAGCTGGT
GTGTCATGTCTCTGGCTTCTACCCAAAACCTGTGTGGGTGATGTGGATGCGGGGTGACCAGGAGCAACAG
GGTACTCACAGAGGTGATTTCCTGCCAAATGCTGATGAGACATGGTATCTTCAAGCAACCCTGGATGTGG
AGGCTGGAGAGGAAGCTGGCCTGGCCTGCAGGGTGAAGCACAGCAGCCTAGGAGGACAGGATATCATCCT
CTACTGGGATGCCAGGCAAGCACCCGTGGGCCTGATCGTCTTCATAGTACTAATCATGCTAGTGGTGGTG
GGTGCTGTAGTCTACTATATCTGGAGAAGGAGAAGCGCTTATCAAGACATCCGGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289449
Insert Size 897 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001289449.1, NP_001276378.1
RefSeq Size 1145 bp
RefSeq ORF 897 bp
Locus ID 12480
Gene Summary This gene encodes a MHC class I-like molecule involved in the presentation of lipid antigens to T cells, and is involved in the activation of Natural Killer T (NKT) cells. The gene is highly similar to the CD1d1 antigen gene, which is located adjacent to this gene in a tail-to-tail fashion. This gene contains a frameshift and does not produce a functional product in the C57BL/6 strain. Alternatively splice transcript variants encoding different isoforms have been found in non-C57BL/6 strains. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (2) has an alternate splice site, compared to variant 1. The reading frame is not affected and the resulting isoform (2) lacks an internal segment, compared to isoform 1. Sequence Note: This RefSeq represents the functional transcript found in 129, NMRI, AKR/J, and other strains.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...