Pphln1 (NM_001285863) Mouse Untagged Clone

CAT#: MC226850

Pphln1 (untagged) - Mouse periphilin 1 (Pphln1), transcript variant 4



  "NM_001285863" in other vectors (1)

CNY 2850.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms CR; HSPC206; HSPC232
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226850 representing NM_001285863
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTGGTCTGAGGGACGCTATGACTACGACCGACTTCCGAGAGAACGCGTGCCTCCCCGGAGCCATCCCA
GTGATGAATCTGGCTACAGATGGCTAAGAGATGATCATTCCACAAGCCGGCAGCCTGACTACAGGGACAT
GAGAGACGGCTTCAGAAGAAAGAGTTTCTACTCTTCACATTATTCGAGAGATCGGTCTCCCCATAAAAGG
GACGCTCCCTTCTTCAGAGAATCCCCTGTCGGCCGGAAGGACTCCCCACACAGCAGATCCGGCTCCAGTG
TCAGCAGCAGAAGCTATTCTCCAGAGCGAAGCAGGACTCACTCCTTCCATCAGTCTCAGCATAGAAGTAA
AGAGAGATCCATCCAGTCAGTGAAAACCTCGAGAGATGCGTCACCCTCAAGTTCCTCAGCAGTTGCTTCA
TCCAAGGCGTTAGACAAACCCAGCAGGCTAACTGAGAAGGAACTTGCTGAGGCTGAAAGCAAGTGGGCTA
ATGAAACACTAGAGAAGTCAGACGAAAGTAACTTGGCTGAAATGAATGAGTTTGAGGCGGGATCCACGGC
ACCCTTATTTATTGACCAGACAGAAGAACCCGAGTCAAACACAGTAGATGGTACAGAACTGTATGAAGAC
AGCCAGCTCAGCAACCGCTCTAAAGCCATTGCCTCGAAAACCAAAGAGATTGAGCAGGTTTACCGACAAG
ACTGCGAGACTTTCGGGATGGTGGTGAAAATGCTGATTGAAAAAGATCCCTCATTAGAAAAGTCTGTCCA
GTTTGCACTGAGGCAGAACTTACACGAGATAGGTGAGCGCTGCGTGGAAGAGCTCAAGCGTTTCATTACT
GAGTATGACAACTCTGCTCAGGACTTTGGAGACCCCTTTTAG


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001285863
Insert Size 882 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001285863.1, NP_001272792.1
RefSeq Size 3900 bp
RefSeq ORF 882 bp
Locus ID 223828
Gene Summary Component of the HUSH complex, a multiprotein complex that mediates epigenetic repression. The HUSH complex is recruited to genomic loci rich in H3K9me3 and is probably required to maintain transcriptional silencing by promoting recruitment of SETDB1, a histone methyltransferase that mediates further deposition of H3K9me3. In the HUSH complex, contributes to the maintenance of the complex at chromatin. Acts as a transcriptional corepressor and regulates the cell cycle, probably via the HUSH complex. The HUSH complex is also involved in the silencing of unintegrated retroviral DNA: some part of the retroviral DNA formed immediately after infection remains unintegrated in the host genome and is transcriptionally repressed. May be involved in epithelial differentiation by contributing to epidermal integrity and barrier formation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (4) differs in the 5' UTR and lacks two alternate in-frame exons in the coding region, compared to variant 1. The encoded isoform (3) is shorter, compared to isoform 1. Both variants 3 and 4 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...