Otx2 (NM_001286483) Mouse Untagged Clone

CAT#: MC226812

Otx2 (untagged) - Mouse orthodenticle homolog 2 (Otx2), transcript variant 4



  "NM_001286483" in other vectors (1)

CNY 2850.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms E130306E05Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226812 representing NM_001286483
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATGTCTTATCTAAAGCAACCGCCTTACGCAGTCAATGGGCTGAGTCTGACCACTTCGGGTATGGACT
TGCTGCATCCCTCCGTGGGCTACCCCGCCACCCCCCGGAAACAGCGAAGGGAGAGGACGACATTTACTAG
GGCACAGCTCGACGTTCTGGAAGCTCTGTTTGCCAAGACCCGGTACCCAGACATCTTCATGAGGGAAGAG
GTGGCACTGAAAATCAACTTGCCAGAATCCAGGGTGCAGGTATGGTTTAAGAATCGAAGAGCTAAGTGCC
GCCAACAGCAGCAGCAGCAGCAGAATGGAGGTCAGAACAAAGTGAGGCCTGCCAAGAAGAAGAGCTCTCC
AGCTCGGGAAGTGAGTTCAGAGAGTGGAACAAGTGGCCAGTTCAGTCCCCCCTCTAGTACCTCAGTCCCA
ACCATTGCCAGCAGCAGTGCTCCAGTGTCTATCTGGAGCCCAGCGTCCATCTCCCCACTGTCTGACCCCT
TGTCCACTTCCTCCTCCTGCATGCAGAGGTCCTATCCCATGACCTATACTCAGGCTTCAGGTTATAGTCA
AGGCTATGCTGGCTCAACTTCCTACTTTGGGGGCATGGACTGTGGATCTTATTTGACCCCTATGCATCAC
CAGCTTCCTGGACCAGGGGCCACACTCAGTCCCATGGGTACCAATGCTGTTACCAGCCATCTCAATCAGT
CCCCAGCTTCTCTTTCCACCCAGGGATATGGAGCTTCAAGCTTGGGTTTTAACTCAACCACTGATTGCTT
GGATTATAAGGACCAAACTGCCTCTTGGAAGCTTAACTTCAATGCTGACTGCTTGGATTATAAAGATCAG
ACGTCCTCATGGAAATTCCAGGTTTTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001286483
Insert Size 870 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286483.1, NP_001273412.1
RefSeq Size 2157 bp
RefSeq ORF 870 bp
Locus ID 18424
Gene Summary This gene encodes a protein that belongs to the homeobox family of transcription factors. The encoded protein plays a role in the development and patterning of the head. This protein regulates development of the choroid plexuses in the brain affecting composition of cerebrospinal fluid in the developing brain and is thought to function in the development of sense organs in the embryo. In humans, mutations in this gene are associated with pituitary hormone deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (4) differs in the 5' UTR and uses an alternate in-frame splice site in the 5' coding region compared to variant 1. The encoded protein (isoform b) is shorter than isoform a. Variants 2, 3 and 4 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...