Gnas (NM_019690) Mouse Untagged Clone
CAT#: MC226594
Gnas (untagged) - Mouse GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus (Gnas), transcript variant 4
CNY 2570.00
货期*
3周
规格
Product images

推荐一起购买 (4)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 5530400H20Rik; A930027G11Rik; C130027O20Rik; G; Ga; Galphas; Gn; Gnas1; Gnasxl; GPSA; Gs-; Gs-alpha; Gsa; GSP; N; Nes; Nesp; Nesp55; Nespl; Oed; Oed-Sml; Oedsml; P; P1; P2; P3; PHP1A; PHP1B; POH; SCG; SCG6; XL |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC226594 representing NM_019690
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGATCGCAGGTCCCGGGCTCAGCAGTGGCGCCGAGCTCGCCATAATTACAACGACCTGTGCCCGCCCA TAGGCCGCCGGGCTGCCACCGCTCTCCTCTGGCTCTCCTGCTCCATTGCTCTCCTCCGCGCCCTAGCCTC TTCCAACGCCCGCGCCCAGCAGCGTGCTGCCCAGCGCCGGAGCTTCCTTAACGCCCACCACCGCTCCGCT GCCGCTGCAGCTGCCGCACAGGTACTCCCTGAGTCCTCTGAATCTGAGTCTGATCACGAGCACGAGGAGG TTGAGCCTGAGCTGGCCCGCCCCGAGTGCCTAGAGTACGATCAGGACGACTACGAGACCGAGACCGATTC TGAGACCGAGCCTGAGTCCGATATCGAATCCGAGACCGAAATCGAGACCGAGCCAGAGACCGAGCCAGAA ACCGAGCCAGAGACCGAGCCAGAGGACGAGCGCGGCCCCCGGGGTGCCACCTTCAACCAGTCACTCACTC AGCGTCTGCACGCTCTGAAGTTGCAGAGCGCCGACGCCTCCCCGAGACGTGCGCAGCCCACCACTCAGGA GCCTGAGAGCGCAAGCGAGGGGGAGGAGCCCCAGCGAGGGCCCTTAGATCAGGATCCTCGGGACCCCGAG GAGGAGCCAGAGGAGCGCAAGGAGGAAAACAGGCAGCCCCGCCGCTGCAAGACCAGGAGGCCAGCCCGCC GTCGCGACCAGTCCCCGGAGTCCCCTCCCAGAAAGGGGCCCATCCCCATCCGGCGTCACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_019690 |
Insert Size | 762 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_019690.3, NP_062664.2 |
RefSeq Size | 1651 bp |
RefSeq ORF | 762 bp |
Locus ID | 14683 |
UniProt ID | Q9Z0F1 |
Gene Summary | This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, which is commonly found in imprinted genes and correlates with transcript expression. This gene has an antisense transcript. One of the transcripts produced from this locus, and the antisense transcript, are both paternally expressed noncoding RNAs, and may regulate imprinting in this region. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Additional transcript variants have been found for this gene, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2015] Transcript Variant: This variant (4) is maternally expressed. It lacks several 3' exons and has alternate 5' and 3' exons, compared to variant 7. Variants 3 and 4 both encode isoform secretogranin VI (SCG6, also known as NESP55), which localizes to large secretory vesicles of endocrine cells and neurons. The coding regions of variants 3 and 4 do not overlap the coding regions used by other transcripts; thus SCG6 has no similarity to isoforms of the G-protein alpha subunit. This variant has an antisense transcript NESPAS. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228805 | Gnas (myc-DDK-tagged) - Mouse GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus (Gnas), transcript variant 4 |
CNY 2570.00 |
Customer
Reviews
Loading...