Ywhaz (NM_001253805) Mouse Untagged Clone

CAT#: MC226535

Ywhaz (untagged) - Mouse tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (Ywhaz), transcript variant 2



  "NM_001253805" in other vectors (1)

CNY 2,380.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
YWHAZ Antibody - C-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 14-3-3zeta; 1110013I11Rik; AI596267; AL022924; AU020854
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226535 representing NM_001253805
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATAAAAATGAGCTGGTGCAGAAGGCCAAGCTGGCCGAGCAGGCAGAGCGATATGATGACATGGCAG
CCTGCATGAAGTCTGTCACTGAGCAGGGAGCTGAGCTGTCGAATGAGGAGAGAAACCTTCTCTCTGTTGC
TTATAAAAACGTTGTAGGAGCCCGTAGGTCATCGTGGAGGGTCGTCTCAAGTATTGAGCAGAAGACGGAA
GGTGCTGAGAAAAAGCAGCAGATGGCTCGAGAATACAGAGAGAAGATCGAGACGGAGCTGCGTGACATCT
GCAACGATGTACTGTCTCTTTTGGAAAAGTTCTTGATCCCCAATGCTTCGCAACCAGAAAGCAAAGTCTT
CTATTTGAAAATGAAGGGTGACTACTACCGTTACTTGGCCGAGGTTGCTGCTGGTGATGACAAGAAAGGA
ATTGTGGACCAGTCACAGCAAGCATACCAAGAAGCATTTGAAATCAGCAAAAAGGAGATGCAGCCGACAC
ACCCCATCAGACTGGGTCTGGCCCTCAACTTCTCTGTGTTCTATTACGAGATCCTGAACTCCCCAGAGAA
AGCCTGCTCTCTTGCAAAAACAGCTTTCGATGAAGCCATTGCTGAACTTGATACATTAAGTGAAGAGTCG
TACAAAGACAGCACGCTAATAATGCAGTTACTGAGAGACAACTTAACATTGTGGACATCGGATACCCAAG
GAGATGAAGCAGAAGCAGGAGAAGGAGGGGAAAATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001253805
Insert Size 738 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001253805.1, NP_001240734.1
RefSeq Size 3604 bp
RefSeq ORF 738 bp
Locus ID 22631
UniProt ID P63101
Gene Summary Adapter protein implicated in the regulation of a large spectrum of both general and specialized signaling pathways. Binds to a large number of partners, usually by recognition of a phosphoserine or phosphothreonine motif. Binding generally results in the modulation of the activity of the binding partner. Induces ARHGEF7 activity on RAC1 as well as lamellipodia and membrane ruffle formation (By similarity). In neurons, regulates spine maturation through the modulation of ARHGEF7 activity (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an internal exon in the 5' UTR, compared to variant 1. Variants 1-3 and 5 encode the same isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...