Cd63 (NM_001282966) Mouse Untagged Clone

CAT#: MC226494

Cd63 (untagged) - Mouse CD63 antigen (Cd63), transcript variant 3



  "NM_001282966" in other vectors (1)

CNY 2380.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CD63 Rabbit monoclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms C75951; ME491; Tspan30
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226494 representing NM_001282966
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGTGGAAGGAGGAATGAAGTGTGTCAAGTTTTTGCTCTACGTTCTCCTGCTGGCCTTCTGCGCCT
GTGCAGTGGGATTGATCGCCATTGGTGTAGCGGTTCAGGTTGTCTTGAAGCAGGCCATTACCCATGAGAC
TACTGCTGGCTCGCTGTTGCCTGTGGTCATCATTGCAGTGGGTGCCTTCCTCTTCCTGGTGGCCTTTGTG
GGCTGCTGTGGGGCCTGCAAGGAGAACTACTGTCTCATGATTACATTTGCCATCTTCCTGTCTCTTATCA
TGCTTGTGGAGGTGGCTGTGGCCATTGCTGGCTATGTGTTTAGAGACCAGGTGAAGTCAGAGTTTAATAA
AAGCTTCCAGCAGCAGATGCAGAATTACCTTAAAGACAACAAAACAGCCACTATTTTGGACAAATTGCAG
AAAGAAAATAACTGCTGTGGAGCTTCTAACTACACAGACTGGGAAAACATCCCCGGCATGGCCAAGGACA
GAGTCCCCGATTCTTGCTGCATCAACATAACTGTGGGCTGTGGGAATGATTTCAAGGAATCCACTATCCA
TACCCAGGGCTGCGTGGAGACTATAGCAATATGGCTAAGGAAGAACATACTGCTGGTGGCTGCAGCGGCC
CTGGGCATTGCTTTTGTGGAGGTCTTGGGAATTATCTTCTCCTGCTGTCTGGTGAAGAGTATTCGAAGTG
GCTATGAAGTAATGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001282966
Insert Size 717 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282966.1, NP_001269895.1
RefSeq Size 999 bp
RefSeq ORF 717 bp
Locus ID 12512
UniProt ID P41731
Gene Summary Functions as cell surface receptor for TIMP1 and plays a role in the activation of cellular signaling cascades. Plays a role in the activation of ITGB1 and integrin signaling, leading to the activation of AKT, FAK/PTK2 and MAP kinases. Promotes cell survival, reorganization of the actin cytoskeleton, cell adhesion, spreading and migration, via its role in the activation of AKT and FAK/PTK2. Plays a role in VEGFA signaling via its role in regulating the internalization of KDR/VEGFR2. Plays a role in intracellular vesicular transport processes, and is required for normal trafficking of the PMEL luminal domain that is essential for the development and maturation of melanocytes. Plays a role in the adhesion of leukocytes onto endothelial cells via its role in the regulation of SELP trafficking. May play a role in mast cell degranulation in response to Ms4a2/FceRI stimulation, but not in mast cell degranulation in response to other stimuli.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) has an alternate 5' UTR exon, compared to variant 1. Variants 1, 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...