Bcl2l1 (NM_001289717) Mouse Untagged Clone

CAT#: MC226458

Bcl2l1 (untagged) - Mouse BCL2-like 1 (Bcl2l1), transcript variant 2



  "NM_001289717" in other vectors (1)

CNY 2280.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Bcl; Bcl(X; Bcl(X)L; bcl-; bcl-x; Bcl-XL; bcl2-L-1; Bcl2l; BclX
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226458 representing NM_001289717
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCTCAGAGCAACCGGGAGCTGGTGGTCGACTTTCTCTCCTACAAGCTTTCCCAGAAAGGATACAGCT
GGAGTCAGTTTAGTGATGTCGAAGAGAATAGGACTGAGGCCCCAGAAGAAACTGAAGCAGAGAGGGAGAC
CCCCAGTGCCATCAATGGCAACCCATCCTGGCACCTGGCGGATAGCCCGGCCGTGAATGGAGCCACTGGC
CACAGCAGCAGTTTGGATGCGCGGGAGGTGATTCCCATGGCAGCAGTGAAGCAAGCGCTGAGAGAGGCAG
GCGATGAGTTTGAACTGCGGTACCGGAGAGCGTTCAGTGATCTAACATCCCAGCTTCACATAACCCCAGG
GACCGCGTATCAGAGCTTTGAGCAGGTAGTGAATGAACTCTTTCGGGATGGAGTAAACTGGGGTCGCATC
GTGGCCTTTTTCTCCTTTGGCGGGGCACTGTGCGTGGAAAGCGTAGACAAGGAGATGCAGGTATTGGTGA
GTCGGATTGCAAGTTGGATGGCCACCTATCTGAATGACCACCTAGAGCCTTGGATCCAGGAGAACGGCGG
CTGGGACACTTTTGTGGATCTCTACGGGAACAATGCAGCAGCCGAGAGCCGGAAAGGCCAGGAGCGCTTC
AACCGCTGGTTCCTGACGGGCATGACTGTGGCTGGTGTGGTTCTGCTGGGCTCACTCTTCAGTCGGAAGT
GA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289717
Insert Size 702 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001289717.1, NP_001276646.1
RefSeq Size 2472 bp
RefSeq ORF 702 bp
Locus ID 12048
UniProt ID Q64373
Gene Summary This gene encodes a member of the Bcl-2 family of apoptosis regulators. The encoded protein is localized to the inner and outer mitochondrial membranes and regulates the programmed cell death pathway during development and tissue homeostasis. This protein binds to voltage-dependent anion channels in the outer mitochondrial membrane to facilitate the uptake of calcium ions. Mice embryos lacking this gene survived for two weeks and exhibited cell death of immature hematopoietic cells and neurons. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 5. Variants 1, 2, 3, and 5 all encode the same isoform (a, also known as Bcl-xL; PMID 7607090). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...