Gdnf (NM_001301332) Mouse Untagged Clone

CAT#: MC226341

Gdnf (untagged) - Mouse glial cell line derived neurotrophic factor (Gdnf), transcript variant 2



  "NM_001301332" in other vectors (1)

CNY 2090.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
GDNF Antibody - middle region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI385739; ATF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226341 representing NM_001301332
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGATTCGGGCCACTTGGAGTTAATGTCCAACTGGGGGTCTACGGAGACCGGATCCGAGGTGCCGCCG
CCGGACGGGACTCTAAGATGAAGTTATGGGATGTCGTGGCTGTCTGCCTGGTGTTGCTCCACACCGCGTC
TGCCTTCCCGCTGCCCGCCGCCAATATGCCTGAAGATTATCCTGACCAGTTTGATGACGTCATGGATTTT
ATTCAAGCCACCATTAAAAGACTGAAAAGGTCACCAGATAAACAAGCGGCAGCGCTTCCTCGAAGAGAGA
GGAATCGGCAGGCTGCAGCTGCCAGCCCAGAGAATTCCAGAGGGAAAGGTCGCAGAGGCCAGAGGGGCAA
AAATCGGGGGTGCGTTTTAACTGCCATACACTTAAATGTCACTGACTTGGGTTTGGGCTATGAAACCAAG
GAGGAACTGATCTTTCGATATTGCAGCGGTTCCTGTGAATCGGCCGAGACAATGTATGACAAAATACTAA
AAAACCTGTCTCGGAGTAGAAGGCTAACAAGTGACAAAGTAGGCCAGGCATGTTGCAGGCCGGTCGCCTT
CGACGACGACCTGTCGTTTTTAGATGACAACCTGGTTTACCATATTCTAAGAAAGCATTCCGCTAAACGG
TGTGGATGTATCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001301332
Insert Size 645 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001301332.1, NP_001288261.1
RefSeq Size 4399 bp
RefSeq ORF 645 bp
Locus ID 14573
UniProt ID P48540
Gene Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Homozygous knockout mice for this gene exhibit defects in kidney development and neonatal death. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (2) has an alternate splice site in the 5' coding region but maintains the reading frame, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...