Fgf12 (NM_001276419) Mouse Untagged Clone

CAT#: MC226300

Fgf12 (untagged) - Mouse fibroblast growth factor 12 (Fgf12), transcript variant 3



  "NM_001276419" in other vectors (1)

CNY 2090.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AV114868; B230343J05Rik; FGF-12; FHF-1; Fhf1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226300 representing NM_001276419
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGATTCTTGCGCTTTCTCTGAAGAAAGGAGTGCATATGCTGCAGTGCCTCTGTGGAAGGAGCCTGA
GGTCCAGCGACAGCCCAAGCGAACCCCAGCTGAAAGGGATTGTGACAAGGTTATTCAGCCAGCAGGGATA
TTTCCTGCAGATGCATCCAGATGGTACCATTGATGGGACCAAGGACGAAAACAGCGACTACACCCTCTTC
AATCTAATTCCTGTAGGACTGCGTGTGGTGGCCATCCAAGGGGTTAAAGCCAGCCTTTATGTGGCCATGA
ATGGAGAAGGCTATCTCTACAGCTCAGATGTTTTTACCCCAGAATGCAAATTTAAGGAGTCTGTGTTTGA
AAACTACTATGTGATCTATTCCTCAACCCTGTATCGCCAGCAGGAATCAGGCCGTGCATGGTTTCTAGGA
CTCAATAAAGAAGGTCAAATCATGAAGGGGAACAGAGTGAAGAAAACCAAGCCCTCATCTCATTTTGTAC
CAAAACCTATTGAAGTGTGTATGTACAGAGAACCATCACTACACGAAATTGGAGAAAAGCAAGGACGCTC
AAGGAAAAGTTCGGGAACACCCACCATGAATGGAGGCAAAGTCGTGAATCAAGATTCTACATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001276419
Insert Size 624 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001276419.2, NP_001263348.1
RefSeq Size 5544 bp
RefSeq ORF 624 bp
Locus ID 14167
UniProt ID P61329
Gene Summary Involved in nervous system development and function. Promote neuronal excitability by elevating the voltage dependence of neuronal sodium channel SCN8A fast inactivation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses an alternate 5' exon structure, differs in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. It encodes isoform c which is shorter and has a distinct N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...