Csrp3 (NM_001198841) Mouse Untagged Clone

CAT#: MC226205

Csrp3 (untagged) - Mouse cysteine and glycine-rich protein 3 (Csrp3), transcript variant 2



  "NM_001198841" in other vectors (1)

CNY 2000.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms CRP3; MLP; MMLP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226205 representing NM_001198841
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCAAACTGGGGTGGAGGTGCAAAATGTGGAGCCTGTGAAAAGACGGTCTACCATGCAGAAGAAATCC
AGTGCAATGGGAGGAGTTTCCACAAGACCTGTTTCCACTGCATGGCCTGCAGGAAAGCTCTGGACAGCAC
CACAGTGGCAGCTCATGAGTCAGAGATCTACTGTAAGGTGTGCTATGGGCGCAGGTATGGCCCCAAGGGG
ATCGGGTTCGGACAAGGCGCTGGCTGCCTCAGCACAGACACTGGCGAGCATCTTGGCCTGCAGTTCCAAC
AATCCCCAAAGCCAGCTCGAGCAGCCACCACAAGCAACCCTTCCAAATTCTCTGCAAAGTTTGGAGAATC
AGAGAAGTGCCCACGATGTGGAAAGTCGGTATACGCTGCTGAGAAGGTCATGGGAGGTGGCAAGCCCTGG
CACAAGACCTGCTTCCGCTGTGCCATCTGTGGGAAGAGCCTGGAGTCTACAAATGTCACTGACAAGGATG
GGGAGCTCTACTGCAAAGTTTGCTATGCCAAAAATTTTGGCCCCACAGGCATTGGGTTTGGAGGGCTTAC
ACAGCAAGTGGAAAAGAAGGAGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001198841
Insert Size 585 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001198841.1, NP_001185770.1
RefSeq Size 1035 bp
RefSeq ORF 585 bp
Locus ID 13009
UniProt ID P50462
Gene Summary Positive regulator of myogenesis. Acts as cofactor for myogenic bHLH transcription factors such as MYOD1, and probably MYOG and MYF6. Enhances the DNA-binding activity of the MYOD1:TCF3 isoform E47 complex and may promote formation of a functional MYOD1:TCF3 isoform E47:MEF2A complex involved in myogenesis (By similarity). Plays a crucial and specific role in the organization of cytosolic structures in cardiomyocytes. Could play a role in mechanical stretch sensing. May be a scaffold protein that promotes the assembly of interacting proteins at Z-line structures. It is essential for calcineurin anchorage to the Z line. Required for stress-induced calcineurin-NFAT activation (PubMed:9039266, PubMed:15665106). The role in regulation of cytoskeleton dynamics by association with CFL2 is reported conflictingly. Proposed to contribute to the maintenance of muscle cell integerity through an actin-based mechanism. Can directly bind to actin filaments, cross-link actin filaments into bundles without polarity selectivity and protect them from dilution- and cofilin-mediated depolymerization; the function seems to involve its self-association (By similarity). In vitro can inhibit PKC/PRKCA activity. Proposed to be involved in cardiac stress signaling by down-regulating excessive PKC/PRKCA signaling (PubMed:27353086).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...