Gpm6a (NM_001253756) Mouse Untagged Clone

CAT#: MC226099

Gpm6a (untagged) - Mouse glycoprotein m6a (Gpm6a), transcript variant 3



  "NM_001253756" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Gpm6; M6A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226099 representing NM_001253756
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGTAGAAGGTTTCTTCACAACTGGGGCTATCAAAGATCTCTATGGAGACTTCAAAATCACCACCTGTG
GCAGATGTGTGAGCGCTTGGTTTATCATGCTGACATACCTCTTCATGTTGGCCTGGCTGGGAGTCACAGC
TTTCACCTCACTGCCCGTGTACATGTATTTCAATGTGTGGACCATCTGCCGGAACACCACTCTAGTGGAG
GGAGCAAATCTCTGCTTGGATCTGCGTCAGTTTGGGATTGTGACAATTGGAGAGGAAAAGAAAATTTGTA
CTGCCTCTGAGAACTTCCTGAGGATGTGTGAATCTACTGAGCTGAATATGACCTTCCACTTGTTCATTGT
GGCACTTGCTGGAGCTGGAGCAGCAGTTATTGCTATGGTCCACTACCTGATGGTTCTGTCTGCCAACTGG
GCCTATGTGAAAGATGCCTGCCGCATGCAGAAGTACGAAGACATCAAGTCAAAGGAAGAGCAGGAGCTGC
ACGACATCCATTCTACTCGCTCCAAAGAGCGGCTCAATGCGTACACATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001253756
Insert Size 540 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001253756.1, NP_001240685.1
RefSeq Size 3158 bp
RefSeq ORF 540 bp
Locus ID 234267
UniProt ID P35802
Gene Summary Involved in neuronal differentiation, including differentiation and migration of neuronal stem cells. Plays a role in neuronal plasticity and is involved in neurite and filopodia outgrowth, filopodia motility and probably synapse formation. Gpm6a-induced filopodia formation involves mitogen-activated protein kinase (MAPK) and Src signaling pathways. Conflictingly, PubMed:22162747 reports that induced cellular protrusions are simple membrane-wrapped tubules without actin or tubulin-based cytoskeletons and with Gpm6a gliding along membrane edges indicative for a function in actin-independent membrane deformation. May be involved in neuronal NGF-dependent Ca(2+) influx. May be involved in regulation of endocytosis and intracellular trafficking of G-protein-coupled receptors (GPCRs); enhances internalization and recycling of mu-type opioid receptor.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) has a different segment in its 5' UTR and lacks an alternate exon in the 5' coding region, which results in the use of a downstream start codon, compared to variant 1. The resulting protein (isoform 3) is shorter when it is compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...