Cryab (NM_001289782) Mouse Untagged Clone

CAT#: MC226080

Cryab (untagged) - Mouse crystallin, alpha B (Cryab), transcript variant 1



  "NM_001289782" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Cry; Crya; Crya-2; Crya2; Hsp; HspB5; P23
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226080 representing NM_001289782
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACATCGCCATCCACCACCCCTGGATCCGGCGCCCCTTCTTCCCCTTCCACTCCCCAAGCCGCCTCT
TCGACCAGTTCTTCGGAGAGCACCTGTTGGAGTCTGACCTCTTCTCAACAGCCACTTCCCTGAGCCCCTT
CTACCTTCGGCCACCCTCCTTCCTGCGGGCACCCAGCTGGATTGACACCGGACTCTCAGAGATGCGTTTG
GAGAAGGACAGATTCTCTGTGAATCTGGACGTGAAGCACTTCTCTCCGGAGGAACTCAAAGTCAAGGTTC
TGGGGGACGTGATTGAGGTCCACGGCAAGCACGAAGAACGCCAGGACGAACATGGCTTCATCTCCAGGGA
GTTCCACAGGAAGTACCGGATCCCAGCCGATGTGGATCCTCTCACCATCACTTCATCCCTGTCATCTGAT
GGAGTCCTCACTGTGAATGGACCAAGGAAACAGGTGTCTGGCCCTGAGCGCACCATTCCCATCACCCGTG
AAGAGAAGCCTGCTGTCGCCGCAGCCCCTAAGAAGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001289782
Insert Size 528 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289782.1, NP_001276711.1
RefSeq Size 1117 bp
RefSeq ORF 528 bp
Locus ID 12955
UniProt ID P23927
Gene Summary This gene encodes a member of the small heat-shock protein (HSP20) family. The encoded protein is a molecular chaperone that protects proteins against thermal denaturation and other stresses. This protein is a component of the eye lens, regulates lens differentiation and functions as a refractive element in the lens. This protein is a negative regulator of inflammation, has anti-apoptotic properties and also plays a role in the formation of muscular tissue. Mice lacking this gene exhibit worse experimental autoimmune encephalomyelitis and inflammation of the central nervous system compared to the wild type. In mouse models, this gene has a critical role in alleviating the pathology of the neurodegenerative Alexander disease. Mutations in the human gene are associated with myofibrillar myopathy 2, fatal infantile hypertonic myofibrillar myopathy, multiple types of cataract and dilated cardiomyopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1 through 4 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...