Clasp2 (NM_001286603) Mouse Untagged Clone

CAT#: MC226038

Clasp2 (untagged) - Mouse CLIP associating protein 2 (Clasp2), transcript variant 8



  "NM_001286603" in other vectors (1)

CNY 2000.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1500004F14Rik; 8030404L10Rik; C77448; CLASP2beta; mKIAA0627
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226038 representing NM_001286603
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTATGGGAGATGATAAAAGCTTTGATGATGAGGAATCAGTGGATGGAAATAGGCCGTCGTCAGCTG
CTTCAGCCTTCAAGGTTCCTGCACCTAAAACACCTGGGAATCCTGTCAGCAGTGCAAGAAAGCCTGGCTC
AGCAGGTGGCCCTAAGGTTGGAGGTCCTTCTAAAGAAGGAGGGGCTGGAGCAGTTGATGAAGATGACTTT
ATAAAAGCTTTTACAGATGTTCCTTCTGTTCAGATCTATTCTAGTCGAGAACTTGAAGAGACGTTAAATA
AGATCAGGGAAATTTTGTCAGATGACAAACATGACTGGGACCAGCGTGCCAATGCGTGCATGTCCTGCAG
CCTGGTAGCCAGTGAGGTTGAGAGAGCTCTGGCCTGGCCTCTGTGGAGTCACCTAGCTACTTATCAGCAC
CATTGTCATTGCACCCTGAGTCATGAGGACTTGCCAGAGAAGAGATTGACTTCTCCTGTGAGCTCGGCAT
TTGTTCAACATTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001286603
Insert Size 504 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286603.1, NP_001273532.1
RefSeq Size 1493 bp
RefSeq ORF 504 bp
Locus ID 76499
UniProt ID Q8BRT1
Gene Summary Microtubule plus-end tracking protein that promotes the stabilization of dynamic microtubules. Involved in the nucleation of noncentrosomal microtubules originating from the trans-Golgi network (TGN). Required for the polarization of the cytoplasmic microtubule arrays in migrating cells towards the leading edge of the cell. May act at the cell cortex to enhance the frequency of rescue of depolymerizing microtubules by attaching their plus-ends to cortical platforms composed of ERC1 and PHLDB2. This cortical microtubule stabilizing activity is regulated at least in part by phosphatidylinositol 3-kinase signaling. Also performs a similar stabilizing function at the kinetochore which is essential for the bipolar alignment of chromosomes on the mitotic spindle. Acts as a mediator of ERBB2-dependent stabilization of microtubules at the cell cortex.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (8) differs in both UTR's and the coding region but maintains the reading frame, compared to variant 3. This results in a protein (isoform h) that is shorter at both the N- and C-termini, compared to isoform c.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...