Apoo (NM_001199338) Mouse Untagged Clone

CAT#: MC226023

Apoo (untagged) - Mouse apolipoprotein O (Apoo), transcript variant 3



  "NM_001199338" in other vectors (1)

CNY 2000.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 0610008C08Rik; 1110019O03Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226023 representing NM_001199338
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAAGATCGATGAGCTTTCACTCTACTCAGTTCCTGAGGGTCAATCTAAATATGTGGAGGAGCCAAGGA
CTCAACTTGAAGAAAACATCTCACAACTCCGACATCATTGTGAGCCATATACAAGTTTCTGTCAGGAAAT
ATACTCCCATACTAAACCCAAGGTGGATCACTTTGTCCAGTGGGGAGTAGACAACTATAACTATCTTCAA
AATGCGCCTCCTGGATTTTTCCCAAGACTCGGTGTTATTGGTTTTGCTGGTTTTGTTGGACTCCTTTTTG
CTAGAGGTTCAAAAATAAAGAAGCTGGTGTATCCTCCTTTTTTCATGGGATTAGGTGCCTCTGTCTATTA
CCCACAACAAGCCATCACCATTGCCCAGATCACTGGGGAGAAGTTATATGACTGGGGATTACGAGGGTAC
ATAGTTATAGAAGATTTGTGGAAGCAAAATTTTCAGAAGCCAGGAAATGTGAAGAATTCACCTGGAAATA
AATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001199338
Insert Size 495 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199338.1, NP_001186267.1
RefSeq Size 1055 bp
RefSeq ORF 495 bp
Locus ID 68316
UniProt ID Q9DCZ4
Gene Summary Component of the MICOS complex, a large protein complex of the mitochondrial inner membrane that plays crucial roles in the maintenance of crista junctions, inner membrane architecture, and formation of contact sites to the outer membrane. Plays a crucial role in crista junction formation and mitochondrial function (By similarity). Can induce cardiac lipotoxicity by enhancing mitochondrial respiration and fatty acid metabolism in cardiac myoblasts (PubMed:24743151). Promotes cholesterol efflux from macrophage cells. Detected in HDL, LDL and VLDL. Secreted by a microsomal triglyceride transfer protein (MTTP)-dependent mechanism, probably as a VLDL-associated protein that is subsequently transferred to HDL (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) contains a different segment for its 5' end which results in the use of a downstream start codon, compared to variant 1. The resulting protein (isoform 3) has a shorter N-terminus when it is compared to isoform 1. Variants 3 and 4 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...