Trp53inp1 (NM_001199105) Mouse Untagged Clone

CAT#: MC226021

Trp53inp1 (untagged) - Mouse transformation related protein 53 inducible nuclear protein 1 (Trp53inp1), transcript variant 2



  "NM_001199105" in other vectors (1)

CNY 2000.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2700057G22Rik; SIP; SIP18; SIP27; Stinp; Teap
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226021 representing NM_001199105
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTTTCAGAGACTGAATAAAATGTTTGTAGGCGAAGTCACTACTTCTTCCAGCCAAGAACCAGAATTCA
GTGAGAAAGAAGATGATGAATGGATTCTTGTTGACTTCATAGATACCTGCCCTGGTTTCTCAGCAGAGGA
AGAGGAAGAAGATGAAGACATTGGTGAAGAGTCCTCAGCAGAGCACACTTCTGTCTTCTCCTGTTTACCT
GCATCTTTGGAATGCTTGACTGACACCAGTGATTCCTGCTTCCTTCAGTTTGAGTCCTGTCCAATGGAGG
AGAGCTGGTTCATCACTCCTCCCCCATGTTTTACAGCAGGTGGATTAACCACTATCAAGGTGGAAACAAG
TCCTATGGAAAACCTTCTCATTGAACATCCCAGCATGTCTGTCTATGCTGTGCACAACTCCTGTCCTGGT
CTCAGTGAGGCGAGTTGTGGAAATGATGAATATAACTCAAGTGGTCCCAGGGCCAGAAAAAGCTGCTTAT
AA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001199105
Insert Size 492 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199105.1, NP_001186034.1
RefSeq Size 5430 bp
RefSeq ORF 492 bp
Locus ID 60599
UniProt ID Q9QXE4
Gene Summary Antiproliferative and proapoptotic protein involved in cell stress response which acts as a dual regulator of transcription and autophagy. Acts as a positive regulator of autophagy. In response to cellular stress or activation of autophagy, relocates to autophagosomes where it interacts with autophagosome-associated proteins GABARAP, GABARAPL1/L2, MAP1LC3A/B/C and regulates autophagy. Acts as an antioxidant and plays a major role in p53/TP53-driven oxidative stress response. Possesses both a p53/TP53-independent intracellular reactive oxygen species (ROS) regulatory function and a p53/TP53-dependent transcription regulatory function. Positively regulates p53/TP53 and p73/TP73 and stimulates their capacity to induce apoptosis and regulate cell cycle. In response to double-strand DNA breaks, promotes p53/TP53 phosphorylation on 'Ser-46' and subsequent apoptosis. Acts as a tumor suppressor by inducing cell death by an autophagy and caspase-dependent mechanism. Can reduce cell migration by regulating the expression of SPARC.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) has an additional exon in the coding region which results in a frameshift and early stop codon, compared to variant 1. It encodes a shorter isoform (2; also known as SIP18) with a distinct C-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...