Plpp2 (NM_001302390) Mouse Untagged Clone

CAT#: MC225982

Ppap2c (untagged) - Mouse phosphatidic acid phosphatase type 2C (Ppap2c), transcript variant 3



  "NM_001302390" in other vectors (1)

CNY 2000.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms L; Lpp2; PAP2-G; PAP2-gamma; PAP2c; Pp; Ppap2c
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225982 representing NM_001302390
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATTGGCCGTCTTCGACCCAGTTTCTTGGCTGTCTGTGACCCTGACTGGAGCCAGGTCAACTGTTCTG
GCTATGTGCAGCTGGAGGTGTGCAGGGGCAGCCCTGCTAATGTCACGGAGGCCAGGCTGTCCTTCTACTC
TGGCCACTCCTCCTTTGGCATGTATTGCATGTTGTTCCTGGCGCTATATGTGCAGGCCCGGCTCTGCTGG
AAGTGGGCACGGCTGCTGAGGCCCACTGTTCAGTTCTTCTTGGTGGCCTTTGCAATCTATGTGGGCTATA
CCCGAGTGTCTGACCACAAGCACCACTGGAGTGATGTCCTTGTCGGCCTCCTGCAGGGAGCCCTGGTGGC
CTGCCTCACGGTCCGCTATGTTTCAGATTTCTTCAAATCCCGGCCACCCCAGCCCTGCCAGGAGGATGAA
GTGCCGGAGCGCAAGCCCAGTCTGTCACTGACGCTGACCCTTGGTGACCGACCCTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302390
Insert Size 477 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302390.1, NP_001289319.1
RefSeq Size 1499 bp
RefSeq ORF 477 bp
Locus ID 50784
UniProt ID Q9DAX2
Gene Summary The protein encoded by this gene is a lipid phosphate phosphohydrolase. It is an integral membrane protein that catalyzes the conversion of phosphatidic acid to diacylglycerol and inorganic phosphate. The transcript is expressed at high levels in lung, liver, and kidney and at low levels in brain and heart. Null mutant mice are viable and fertile and display no overt phenotypic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (3) differs in the 5' UTR and lacks an exon in the 5' coding region, which results in use of a downstream start codon compared to variant 1. The encoded isoform (3) has a distinct N-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...