Cd84 (NM_001252472) Mouse Untagged Clone
CAT#: MC225870
Cd84 (untagged) - Mouse CD84 antigen (Cd84), transcript variant 2
CNY 2000.00
货期*
3周
规格
Product images

推荐一起购买 (3)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | A130013D22Rik; CDw84; SLAMF5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225870 representing NM_001252472
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCCCAGCGCCATCTGTGGATCTGGTTCCTTTGCCTACAAACCTGGTCTGAAGCAGCAGGAAAAGATG CAGACCCGGTGGTAATGAATGGGATTCTTGGGGAGTCAGTTACTTTCCTCTTAAATATTCAAGAACCAAA GAAAATTGACAACATTGCCTGGACTTCTCAATCATCTGTTGCTTTTATAAAACCAGGAGTCAATAAAGCT GAAGTTACCATAACCCAGGGCACTTATAAAGGACGAATAGAAATCATAGATCAGAAGTATGACCTGGTCA TTAGAGACCTGAGGATGGAAGATGCAGGAACTTACAAAGCAGACATCAATGAAGAGAATGAGGAAACCAT CACCAAGATCTACTACCTTCATATCTACCGTAAGTTATGGCAGCACGGGGCCTTGGATTTACTTTTGATT TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001252472 |
Insert Size | 423 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001252472.1, NP_001239401.1 |
RefSeq Size | 3520 bp |
RefSeq ORF | 423 bp |
Locus ID | 12523 |
UniProt ID | Q18PI6 |
Gene Summary | Self-ligand receptor of the signaling lymphocytic activation molecule (SLAM) family. SLAM receptors triggered by homo- or heterotypic cell-cell interactions are modulating the activation and differentiation of a wide variety of immune cells and thus are involved in the regulation and interconnection of both innate and adaptive immune response. Activities are controlled by presence or absence of small cytoplasmic adapter proteins, SH2D1A/SAP and/or SH2D1B/EAT-2 (PubMed:20962259). Can mediate natural killer (NK) cell cytotoxicity dependent on SH2D1A and SH2D1B (PubMed:20962259). Increases proliferative responses of activated T-cells and SH2D1A/SAP does not seen be required for this process. Homophilic interactions enhance interferon gamma/IFNG secretion in lymphocytes and induce platelet stimulation via a SH2D1A/SAP-dependent pathway. May serve as a marker for hematopoietic progenitor cells (By similarity). Required for a prolonged T-cell:B-cell contact, optimal T follicular helper function, and germinal center formation (PubMed:20153220). In germinal centers involved in maintaining B cell tolerance and in preventing autoimmunity (PubMed:25801429). In mast cells negatively regulates high affinity immunoglobulin epsilon receptor signaling; independent of SH2D1A and SH2D1B but implicating FES and PTPN6/SHP-1 (By similarity). In macrophages enhances LPS-induced MAPK phosphorylation and NF-kappaB activation and modulates LPS-induced cytokine secretion; involving ITSM 2 (PubMed:20628063). Positively regulates macroautophagy in primary dendritic cells via stabilization of IRF8; inhibits TRIM21-mediated proteasomal degradation of IRF8 (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks several exons and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. It encodes isoform 2 which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR228081 | Cd84 (myc-DDK-tagged) - Mouse CD84 antigen (Cd84), transcript variant 2 |
CNY 1900.00 |
Customer
Reviews
Loading...