Dnajc19 (NM_001286972) Mouse Untagged Clone

CAT#: MC225800

Dnajc19 (untagged) - Mouse DnaJ (Hsp40) homolog, subfamily C, member 19 (Dnajc19), transcript variant 3



  "NM_001286972" in other vectors (1)

CNY 2000.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Dnajc19 Antibody - N-terminal region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1810055D05Rik; AA959924; Tim14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225800 representing NM_001286972
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCCAGCACAGTGGTAGCAGTCGGGTTGACCATTGCTGCTGCAGGATTTGCAGGCCGTTATGTTTTAC
AAGCCATGAAGCATGTGGAGCCTCAAGTAAAACAAGTTTTTCAGAGCCTACCAAAATCTGCATTCGGTGG
TGGGTACTACAGAGGTGGATTTGAACCCAAAATGACAAAACGGGAAGCAGCATTAATATTAGGTGTAAGC
CCTACTGCCAATAAAGGGAAGATCAGGGATGCTCATCGCCGGATTATGCTATTAAATCACCCAGACAAGG
GTAAGCAACTTTTATTACTATACTGGACTGTTAATGGAATAGCTAATTCTTGGTGTTATGAATGTCTGTG
TGTGAGCAGTTTCCCAGTTGTGGATCACATTGTAGTGTCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001286972
Insert Size 393 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286972.1, NP_001273901.1
RefSeq Size 1871 bp
RefSeq ORF 393 bp
Locus ID 67713
UniProt ID Q9CQV7
Gene Summary Probable component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner. May act as a co-chaperone that stimulate the ATP-dependent activity (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) contains a 3' terminal exon that extends past a splice site that is used in variant 2. This results in a novel 3' coding region and 3' UTR compared to variant 2. It encodes isoform 3 which is shorter and has a distinct C-terminus compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...