Cenpa (NM_001302132) Mouse Untagged Clone

CAT#: MC225702

Cenpa (untagged) - Mouse centromere protein A (Cenpa), transcript variant 5



  "NM_001302132" in other vectors (1)

CNY 2000.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Cen; Cenp-A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC225702 representing NM_001302132
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGCCCGCGTCGCAAACCGCAGACCCCAAGGAGGAGACCCTCCAGCCCGGCGCCTGGACCCTCGCGAC
AGAGCTCCAGTGTAGGCTCTCAGACACTGCGCAGAAGACAGAAATTCATGTGGCTTAAGGAAATCAAGAC
CCTGCAGAAGAGCACAGACCTCTTGTTCAGGAAGAAGCCTTTCAGCATGGTTGTTAGAGAAATATGTGAG
AAGTTCAGCCGTGGTGTGGATTTTTGGTGGCAAGCCCAGGCCTTGTTGGCCCTTCAGGAGACATTACCTG
GAAGCTTTTGGAGTTGCAGCTTGACAGTGGTGTCGGAGGAGCTGGCTGGGTTTTGCTGTTTTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001302132
Insert Size 345 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001302132.1, NP_001289061.1
RefSeq Size 1213 bp
RefSeq ORF 345 bp
Locus ID 12615
UniProt ID O35216
Gene Summary Centromeres are the differentiated chromosomal domains that specify the mitotic behavior of chromosomes. This gene encodes a centromere protein which contains a histone H3 related histone fold domain that is required for targeting to the centromere. Centromere protein A is proposed to be a component of a modified nucleosome or nucleosome-like structure in which it replaces 1 or both copies of conventional histone H3 in the (H3-H4)2 tetrameric core of the nucleosome particle. The protein is a replication-independent histone that is a member of the histone H3 family. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (5) lacks a 3' exon, which results in a frameshift, compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...