Crk (NM_001277221) Mouse Untagged Clone
CAT#: MC225543
Crk (untagged) - Mouse v-crk sarcoma virus CT10 oncogene homolog (avian) (Crk), transcript variant 3
CNY 2000.00
货期*
3周
规格
Product images

推荐一起购买 (3)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | c-Crk; Cr; Crk-I; Crk-II; Crk-III; Crk3; CrkIII; Crko; p38 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC225543 representing NM_001277221
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGGCAACTTCGACTCGGAGGAGCGGAGTAGCTGGTACTGGGGCCGCCTGAGCCGGCAGGAGGCGG TGGCGCTATTGCAGGGCCAGCGGCACGGGGTGTTCCTGGTGCGGGACTCGAGCACCAGCCCCGGGGACTA TGTGCTTAGCGTCTCCGAAAACTCGCGCGTCTCCCACTACATCATCAACAGCAGCGGCCCGCGCCCTCCA GTGCCTCCGTCGCCCGCTCAGCCTCCGCCGGGTCGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001277221 |
Insert Size | 249 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001277221.1, NP_001264150.1 |
RefSeq Size | 5469 bp |
RefSeq ORF | 249 bp |
Locus ID | 12928 |
Gene Summary | This gene is part of a family of adapter proteins that mediate formation of signal transduction complexes in response to extracellular stimuli, such as growth and differentiation factors. Protein-protein interactions occur through the SH2 domain, which binds phosphorylated tyrosine residues, and the SH3 domain, which binds proline-rich peptide motifs. These interactions promote recruitment and activation of effector proteins to regulate cell migration, adhesion, and proliferation. In mouse this protein is essential for embryonic development. Alternatively spliced transcripts encoding different isoforms with distinct biological activity have been described. [provided by RefSeq, Mar 2013] Transcript Variant: This variant (3) lacks an alternate, in-frame exon in the coding region compared to variant 1. The encoded isoform (3) is shorter than isoform 1 (CrkI). Isoform 3 does not have a complete SH2 domain and lacks an SH3 domain, both of which are found in isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR227754 | Crk (myc-DDK-tagged) - Mouse v-crk sarcoma virus CT10 oncogene homolog (avian) (Crk), transcript variant 3 |
CNY 1900.00 |
Customer
Reviews
Loading...