Ar (NM_013476) Mouse Untagged Clone

CAT#: MC222457

Ar (untagged) - Mouse androgen receptor (Ar), (10ug)



  "NM_013476" in other vectors (4)

CNY 6,592.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AW320017; Tfm
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC222457 representing NM_013476
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC



AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAG
GTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-RsrII     
ACCN NM_013476
Insert Size 2700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_013476.3, NP_038504.1
RefSeq Size 2999 bp
RefSeq ORF 2700 bp
Locus ID 11835
UniProt ID P19091
Gene Summary This gene encodes a nuclear hormone receptor containing zinc finger and DNA-binding domains. The encoded protein is a key regulator of signalling by androgens, a class of steroid hormones involved in male reproductive development. The protein responds to hormone signalling by translocating to the nucleus, forming dimers, and binding to androgen response elements (AREs) in the promoters of target genes, which are subsequently transcriptionally activated. Activity of this protein is negatively regulated by nuclear receptor subfamily 0 group B member 1 (Nr0b1, also known as Dax1). Mutations in this gene result in feminized genitals and infertility in male animals. Loss of function in female animals also causes problems in reproductive development and function. [provided by RefSeq, May 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...