Sfpq (NM_023603) Mouse Untagged Clone
CAT#: MC220596
Sfpq (untagged) - Mouse splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated) (Sfpq), (10ug)
CNY 9030.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110004P21Rik; 2810416M14Rik; 5730453G22Rik; 9030402K04Rik; AU021830; D4Ertd314e |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC220596 representing NM_023603
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTCGGGATCGGTTCCGGAGTCGCGGTGGCGGCGGTGGAGGCTTTCACCGGCGTGGAGGAGGTGGCG GCCGCGGCGGCCTTCACGACTTCCGCTCTCCGCCGCCGGGCATGGGCCTCAACCAGAACCGCGGCCCCAT GGGCCCGGGCCCTGGCGGCCCGAAGCCGCCGCTCCCGCCTCCACCTCCTCACCAGCAGCAGCAGCAGCCG CCGCCGCAGCAGCCTCCGCCGCAGCAGCCGCCGCCGCACCAGCAGCCGCCGCCGCACCAGCCGCCCCATC AACAGCCCCCGCCTCCGCCGCAGGAATCCAAGCCCGTCGTCCCCCAAGGCCCCGGCTCGGCGCCGGGGGT GAGCAGTGCGCCTCCGCCGGCGGTCTCGGCTCCGCCCGCCAACCCCCCGACCACCGGCGCCCCTCCGGGC CCTGGTCCAACCCCGACTCCGCCGCCCGCCGTCCCCTCCACCGCCCCCGGACCGCCTCCCCCATCGACGC CGAGCAGCGGAGTCTCGACCACCCCTCCACAGACCGGCGGCCCTCCGCCACCGCCCGCCGGGGGCGCCGG GCCGGGGCCTAAGCCGGGGCCAGGCCCTGGCGGTCCAAAAGGCGGCAAGATGCCCGGTGGGCCTAAGCCT GGAGGTGGCCCGGGCATGGGCGCTCCTGGTGGCCACCCGAAGCCACCACACCGAGGTGGCGGCGAGCCCC GTGGGGGCCGGCAGCATCATGCGCCCTACCACCAGCAGCACCACCAGGGGCCCCCTCCCGGCGGACCGGG ACCGCGCACGGAGGAGAAGATCTCCGACTCGGAGGGATTTAAAGCCAACTTGTCTCTCTTGCGGAGGCCT GGAGAAAAAACTTACACACAGCGCTGTCGGTTGTTTGTGGGGAATCTACCTGCTGATATCACAGAGGATG AATTCAAAAGACTGTTTGCTAAATACGGAGAACCCGGAGAAGTTTTTATCAACAAAGGCAAAGGGTTCGG GTTCATTAAGCTTGAATCTAGAGCCTTGGCTGAAATCGCCAAAGCTGAGCTTGATGATACTCCCATGAGA GGTAGACAGCTTCGGGTTCGATTTGCCACACACGCTGCAGCCCTGTCTGTTCGAAATCTCTCTCCTTATG TTTCCAACGAACTTTTGGAAGAGGCCTTTAGCCAGTTTGGTCCTATTGAAAGGGCTGTTGTAATTGTGGA TGATCGCGGAAGATCTACAGGGAAAGGCATTGTTGAGTTTGCTTCCAAGCCAGCAGCAAGAAAAGCATTT GAAAGATGCAGTGAAGGTGTTTTCCTACTGACAACGACTCCTCGCCCAGTCATTGTGGAACCACTTGAAC AGTTAGATGACGAAGATGGTCTTCCTGAAAAGCTGGCCCAGAAGAATCCAATGTATCAAAAGGAGAGAGA AACACCACCTCGTTTTGCTCAGCATGGCACATTTGAGTATGAATATTCTCAACGATGGAAGTCCTTGGAT GAAATGGAAAAACAGCAAAGGGAACAAGTTGAAAAAAACATGAAGGATGCTAAAGACAAATTGGAAAGTG AAATGGAAGATGCTTACCATGAACACCAAGCAAATCTTTTGCGCCAAGATCTGATGAGACGCCAGGAAGA ATTAAGGCGCATGGAGGAACTTCACAGTCAAGAAATGCAGAAACGTAAAGAAATGCAGTTGAGGCAAGAG GAGGAACGGCGTAGACGAGAGGAAGAGATGATGATTCGCCAACGTGAGATGGAAGAACAAATGAGACGCC AACGAGAAGAAAGTTACAGCAGGATGGGCTACATGGATCCAAGAGAAAGAGACATGAGAATGGGTGGTGG TGGAACAATGAACATGGGAGATCCCTATGGTTCAGGAGGCCAGAAATTTCCACCACTAGGTGGTGGTGGT GGCATAGGTTATGAAGCTAATCCTGGAGTTCCACCAGCAACCATGAGTGGTTCCATGATGGGAAGCGACA TGCGTACTGAGCGCTTTGGGCAGGGAGGTGCGGGTCCTGTGGGTGGACAGGGTCCTAGAGGAATGGGGCC TGGAACTCCAGCAGGATATGGTAGAGGGAGAGAAGAGTATGAAGGGCCAAATAAAAAACCCCGATTTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_023603 |
Insert Size | 2100 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_023603.3, NP_076092.1 |
RefSeq Size | 3500 bp |
RefSeq ORF | 2100 bp |
Locus ID | 71514 |
UniProt ID | Q8VIJ6 |
Gene Summary | DNA- and RNA binding protein, involved in several nuclear processes. Essential pre-mRNA splicing factor required early in spliceosome formation and for splicing catalytic step II, probably as a heteromer with NONO. Binds to pre-mRNA in spliceosome C complex, and specifically binds to intronic polypyrimidine tracts. Involved in regulation of signal-induced alternative splicing. During splicing of PTPRC/CD45, a phosphorylated form is sequestered by THRAP3 from the pre-mRNA in resting T-cells; T-cell activation and subsequent reduced phosphorylation is proposed to lead to release from THRAP3 allowing binding to pre-mRNA splicing regulatotry elements which represses exon inclusion. Interacts with U5 snRNA, probably by binding to a purine-rich sequence located on the 3' side of U5 snRNA stem 1b. May be involved in a pre-mRNA coupled splicing and polyadenylation process as component of a snRNP-free complex with SNRPA/U1A. The SFPQ-NONO heteromer associated with MATR3 may play a role in nuclear retention of defective RNAs. SFPQ may be involved in homologous DNA pairing; in vitro, promotes the invasion of ssDNA between a duplex DNA and produces a D-loop formation. The SFPQ-NONO heteromer may be involved in DNA unwinding by modulating the function of topoisomerase I/TOP1; in vitro, stimulates dissociation of TOP1 from DNA after cleavage and enhances its jumping between separate DNA helices. The SFPQ-NONO heteromer binds DNA. The SFPQ-NONO heteromer may be involved in DNA non-homologous end joining (NHEJ) required for double-strand break repair and V(D)J recombination and may stabilize paired DNA ends; in vitro, the complex strongly stimulates DNA end joining, binds directly to the DNA substrates and cooperates with the Ku70/G22P1-Ku80/XRCC5 (Ku) dimer to establish a functional preligation complex. SFPQ is involved in transcriptional regulation. Functions as transcriptional activator (By similarity). Transcriptional repression is mediated by an interaction of SFPQ with SIN3A and subsequent recruitment of histone deacetylases (HDACs). The SFPQ-NONO-NR5A1 complex binds to the CYP17 promoter and regulates basal and cAMP-dependent transcriptional activity. SFPQ isoform Long binds to the DNA binding domains (DBD) of nuclear hormone receptors, like RXRA and probably THRA, and acts as transcriptional corepressor in absence of hormone ligands. Binds the DNA sequence 5'-CTGAGTC-3' in the insulin-like growth factor response element (IGFRE) and inhibits IGF-I-stimulated transcriptional activity (By similarity). Regulates the circadian clock by repressing the transcriptional activator activity of the CLOCK-ARNTL/BMAL1 heterodimer. Required for the transcriptional repression of circadian target genes, such as PER1, mediated by the large PER complex through histone deacetylation (PubMed:21680841, PubMed:22966205). Required for the assembly of nuclear speckles (By similarity). Plays a role in the regulation of DNA virus-mediated innate immune response by assembling into the HDP-RNP complex, a complex that serves as a platform for IRF3 phosphorylation and subsequent innate immune response activation through the cGAS-STING pathway (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the functional protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG210120 | Sfpq (tGFP-tagged) - Mouse splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated) (Sfpq) |
CNY 7600.00 |
|
MR210120 | Sfpq (Myc-DDK-tagged) - Mouse splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated) (Sfpq) |
CNY 8192.00 |
|
MR210120L3 | Lenti ORF clone of Sfpq (Myc-DDK-tagged) - Mouse splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated) (Sfpq) |
CNY 8840.00 |
|
MR210120L4 | Lenti ORF clone of Sfpq (mGFP-tagged) - Mouse splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated) (Sfpq) |
CNY 8840.00 |