Foxo1 (NM_019739) Mouse Untagged Clone
CAT#: MC220091
Foxo1 (untagged) - Mouse forkhead box O1 (Foxo1), (10ug)
CNY 4864.00
CNY 8360.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Afxh; AI876417; FKHR; Fkhr1; Foxo1a |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC220091 representing NM_019739
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC TGGATTACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-RsrII |
ACCN | NM_019739 |
Insert Size | 1959 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_019739.3, NP_062713.2 |
RefSeq Size | 5552 bp |
RefSeq ORF | 1959 bp |
Locus ID | 56458 |
UniProt ID | Q9R1E0 |
Gene Summary | Transcription factor that is the main target of insulin signaling and regulates metabolic homeostasis in response to oxidative stress. Binds to the insulin response element (IRE) with consensus sequence 5'-TT[G/A]TTTTG-3' and the related Daf-16 family binding element (DBE) with consensus sequence 5'-TT[G/A]TTTAC-3'. Activity suppressed by insulin. Main regulator of redox balance and osteoblast numbers and controls bone mass. Orchestrates the endocrine function of the skeleton in regulating glucose metabolism. Acts synergistically with ATF4 to suppress osteocalcin/BGLAP activity, increasing glucose levels and triggering glucose intolerance and insulin insensitivity. Also suppresses the transcriptional activity of RUNX2, an upstream activator of osteocalcin/BGLAP. In hepatocytes, promotes gluconeogenesis by acting together with PPARGC1A and CEBPA to activate the expression of genes such as IGFBP1, G6PC and PCK1. Important regulator of cell death acting downstream of CDK1, PKB/AKT1 and STK4/MST1. Promotes neural cell death. Mediates insulin action on adipose tissue. Regulates the expression of adipogenic genes such as PPARG during preadipocyte differentiation and, adipocyte size and adipose tissue-specific gene expression in response to excessive calorie intake. Regulates the transcriptional activity of GADD45A and repair of nitric oxide-damaged DNA in beta-cells. Required for the autophagic cell death induction in response to starvation or oxidative stress in a transcription-independent manner. Mediates the function of MLIP in cardiomyocytes hypertrophy and cardiac remodeling (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227240 | Foxo1 (tGFP-tagged) - Mouse forkhead box O1 (Foxo1), (10ug) |
CNY 6456.00 |
|
MR227240 | Foxo1 (Myc-DDK-tagged) - Mouse forkhead box O1 (Foxo1) |
CNY 4856.00 |
|
MR227240L1 | Lenti ORF clone of Foxo1 (Myc-DDK-tagged) - Mouse forkhead box O1 (Foxo1) |
CNY 7600.00 |
|
MR227240L2 | Lenti ORF clone of Foxo1 (mGFP-tagged) - Mouse forkhead box O1 (Foxo1) |
CNY 7256.00 |
|
MR227240L3 | Lenti ORF clone of Foxo1 (Myc-DDK-tagged) - Mouse forkhead box O1 (Foxo1) |
CNY 7600.00 |
|
MR227240L4 | Lenti ORF clone of Foxo1 (mGFP-tagged) - Mouse forkhead box O1 (Foxo1) |
CNY 7256.00 |