Znrf1 (NM_133206) Mouse Untagged Clone

CAT#: MC218756

Znrf1 (untagged) - Mouse zinc and ring finger 1 (Znrf1), transcript variant 1, (10ug)



  "NM_133206" in other vectors (6)

CNY 6940.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms B830022L21Rik; nin283; Rnf42; Zrfp1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC218756 representing NM_133206
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGGGGCAAGCAGAGCACGGCGGCCCGCTCTCGGGGCCCCTTCCCGGGGGTCTCTACGGATGACAGCG
CCGTGCCGCCGCCGGGAGGGGCGCCCCACTTTGGGCACTACCGGACGGGCGGCGGGGCGATGGGGCTGCG
CAGCCGCTCGGTCAGCTCGGTGGCGGGCATGGGCATGGACCCCAGCACGGCCGGAGGGGTGCCCTTTAGT
CTCTACACCCCCGCCTCCCGCGGGACCGGCGACTCCGAGAGGGCGCCGGGCGGCGGAGGGTCCACGTCGG
ACTCCACCTATGCCCACGGCAATGGTTACCAAGAGACCGGCGGCGGTCACCATAGAGACGGGATGCTGTA
CCTGGGCTCCCGAGCCTCGCTGGCGGATGCTCTACCTCTGCACATCGCACCCAGGTGGTTCAGCTCGCAC
AGTGGTTTCAAGTGCCCCATTTGTTCCAAGTCTGTGGCTTCCGATGAGATGGAAATGCACTTTATAATGT
GTCTGAGCAAGCCTCGCCTGTCCTACAATGATGATGTGCTGACTAAAGATGCGGGTGAGTGTGTGATCTG
CCTGGAGGAGCTGCTTCAGGGGGACACGATAGCCAGGCTGCCTTGCCTGTGCATCTATCACAAAAGCTGC
ATAGACTCATGGTTTGAAGTGAACAGATCTTGTCCAGAGCACCCTGCTGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_133206
Insert Size 684 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_133206.3, NP_573469.1
RefSeq Size 5562 bp
RefSeq ORF 684 bp
Locus ID 170737
UniProt ID Q91V17
Gene Summary E3 ubiquitin-protein ligase that mediates the ubiquitination of AKT1 and GLUL, thereby playing a role in neuron cells differentiation. Plays a role in the establishment and maintenance of neuronal transmission and plasticity. Regulates Schwann cells differentiation by mediating ubiquitination of GLUL. Promotes Wallerian degeneration, a neurodegeneration disorder, by mediating 'Lys-48'-linked polyubiquitination and subsequent degradation of AKT1 in axons: degradation of AKT1 prevents AKT1-mediated phosphorylation of GSK3B, leading to GSK3B activation and phosphorylation of DPYSL2/CRMP2 followed by destabilization of microtubule assembly in axons.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Variants 1, 2, and 5 all encode the same isoform (a). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...