Mxra8 (NM_024263) Mouse Untagged Clone

CAT#: MC218749

Mxra8 (untagged) - Mouse matrix-remodelling associated 8 (Mxra8), (10ug)



  "NM_024263" in other vectors (5)

CNY 6940.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1200013A08Rik; 1700095D18Rik; AI131686; Asp3; Dicam
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC218749 representing NM_024263
Red=Cloning site Blue=ORF Orange=Stop codon

GCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCCGGCGCGCCAGATCTC
AAGCTTAACTAGCTAGCGGACCGAC

ATGGAGCTGCTGTCCCGCGTCCTGCTGTGGAAACTGCTGCTTCTTCAGAGCTCTGCAGTCCTGTCCTCAG
GGCCTTCAGGGACCGCAGCAGCCAGCAGCTCTCTGGTGTCTGAGTCTGTGGTGAGCTTGGCAGCCGGAAC
CCAGGCTGTGCTACGCTGCCAGAGCCCCCGCATGGTGTGGACCCAAGACCGGCTGCATGATCGCCAGCGC
GTGGTCCACTGGGACCTCAGCGGGGGCCCGGGCAGCCAACGGCGCCGACTTGTGGATATGTATTCGGCGG
GTGAACAGCGCGTGTACGAGCCGCGCGATCGCGACCGCCTCCTGCTGTCGCCTTCTGCTTTCCACGACGG
CAACTTCTCGCTGCTCATTCGCGCTGTGGACAGAGGCGATGAAGGGGTGTACACCTGCAACCTGCACCAT
CACTACTGCCACCTCGATGAGAGCCTGGCTGTGCGCCTCGAGGTTACAGAGGATCCCCTATTAAGTCGCG
CATACTGGGACGGTGAGAAGGAAGTGTTGGTGGTGGCCCATGGCGCGCCGGCACTGATGACCTGCATCAA
CCGTGCGCACGTGTGGACTGACCGCCATTTAGAGGAGGCGCAGCAGGTGGTCCATTGGGACCGACAGCTA
CCTGGGGTGTCACACGACCGCGCCGACCGCCTGCTTGACCTGTATGCATCTGGCGAGCGCCGCGCCTATG
GGCCACCCTTCCTGCGTGATCGCGTGTCAGTGAACACCAACGCTTTTGCACGCGGTGACTTCTCCCTACG
CATCGATGAGCTGGAGCGAGCTGATGAGGGCATCTATTCCTGCCACCTGCACCATCACTACTGTGGCCTC
CACGAGCGCCGAGTCTTCCACCTACAGGTCACAGAGCCTGCCTTTGAGCCACCAGCTCGTGCTTCTCCTG
GCAATGGGTCTGGTCACAGCAGTGCTCCTAGCCCAGATCCCACCCTGACCCGAGGCCACAGCATCATCAA
TGTCATTGTCCCAGAGGACCACACACATTTCTTCCAGCAACTGGGCTATGTGTTGGCCACGCTGCTGCTC
TTCATCTTGCTGCTCATCACTGTAGTCCTGGCTACACGATATCGTCACAGCGGAGGATGCAAGACGTCGG
ACAAAAAAGCTGGGAAGTCAAAGGGGAAGGATGTGAACATGGTGGAGTTTGCTGTAGCCACAAGGGATCA
GGCTCCATATAGGACTGAGGACATCCAGCTAGATTACAAAAACAACATCCTGAAGGAGAGGGCTGAGCTG
GCCCATAGTCCTCTGCCTGCCAAGGATGTGGATCTGGATAAAGAGTTCAGGAAGGAGTACTGCAAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites RsrII-MluI     
ACCN NM_024263
Insert Size 1329 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_024263.4, NP_077225.4
RefSeq Size 2280 bp
RefSeq ORF 1329 bp
Locus ID 74761
UniProt ID Q9DBV4
Gene Summary Transmembrane protein which can modulate activity of various signaling pathways, probably via binding to integrin ITGAV:ITGB3 (PubMed:18366072, PubMed:22492581, PubMed:29702220). Mediates heterophilic cell-cell interactions in vitro (PubMed:18366072). Inhibits osteoclastogenesis downstream of TNFSF11/RANKL and CSF1, where it may function by attenuating signaling via integrin ITGB3 and MAP kinase p38 (PubMed:22492581). Plays a role in cartilage formation where it promotes proliferation and maturation of growth plate chondrocytes (PubMed:29702220). Stimulates formation of primary cilia in chondrocytes (PubMed:29702220). Enhances expression of genes involved in the hedgehog signaling pathway in chondrocytes, including the hedgehog signaling molecule IHH; may also promote signaling via the PTHLH/PTHrP pathway (PubMed:29702220). Plays a role in angiogenesis where it suppresses migration of endothelial cells and also promotes their apoptosis (By similarity). Inhibits VEGF-induced activation of AKT and p38 MAP kinase in endothelial cells (By similarity). Also inhibits VTN (vitronectin)-mediated integrin ITGAV:ITGB3 signaling and activation of PTK2/FAK (By similarity). May play a role in the maturation and maintenance of the blood-brain barrier (PubMed:14603461).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...