Rnls (NM_001167818) Mouse Untagged Clone

CAT#: MC218391

Rnls (untagged) - Mouse renalase, FAD-dependent amine oxidase (Rnls), transcript variant 1, (10ug)



  "NM_001167818" in other vectors (3)

CNY 2400.00

CNY 6940.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rnls Antibody - middle region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 6530404N21Rik; AI452315; AW060440; C10orf59
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC218391 representing NM_001167818
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGATTACTGCCAGCAGTCCTCATAATCCCCGATGCACAGCTGACTTGGGAGCTCAGTACATCACCTGCT
CTCCTCATTATGTCAAAGAGCACCAAAATTTTTATGAGGAACTGTTAGCTCATGGAATTTTGAAGCCTCT
GACATCCCCCATTGAAGGAATGAAAGGGAAGGAAGGAGATTGCAACTTTGTGGCACCTCAAGGATTTTCT
TCAGTTATCAAGTACTACTTGAAAAAGTCAGGTGCAGAAGTCTCCCTCAAGCACTGTGTGACTCAGATCC
ACCTGAAAGATAACAAGTGGGAAGTCTCCACAGACACTGGCTCTGCTGAGCAGTTTGACCTTGTCATCCT
CACCATGCCAGCTCCTCAGATTCTGGAACTTCAAGGTGACATTGTGAACTTAATTAGTGAACGCCAGAGG
GAGCAACTGAAATCTGTGAGCTACTCCTCTCGCTATGCTCTGGGCCTCTTTTATGAAGTAGGCATGAAGA
TTGGTGTCCCTTGGTCCTGCCGCTACCTCAGCAGTCACCCCTGCATATGCTTCATCTCCATTGATAATAA
GAAGCGCAATATAGAGTCATCAGAATGTGGTCCATCCGTGGTGATCCAAACCACTGTCCCATTTGGAGTT
CAACACTTGGAGGCCAGTGAGGCGGATGTGCAGAAGTTAATGATCCAGCAATTGGAAACCATTCTGCCGG
GTTTGCCTCAGCCAGTTGCTACCATATGCCATAAATGGACATATTCACAGGTTACAAGCTCAGTTTCCGA
CAGACCTGGTCAGATGACTCTTCATCTCAAGCCTTTCCTGGTGTGCGGAGGGGATGGATTTACTCACTCC
AACTTCAATGGCTGCATCTCCTCTGCCCTGAGTGTCATGAAAGTTTTAAAGCGTTATATTTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001167818
Insert Size 903 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001167818.1, NP_001161290.1
RefSeq Size 1632 bp
RefSeq ORF 903 bp
Locus ID 67795
UniProt ID A7RDN6
Gene Summary Catalyzes the oxidation of the less abundant 1,2-dihydro-beta-NAD(P) and 1,6-dihydro-beta-NAD(P) to form beta-NAD(P)(+). The enzyme hormone is secreted by the kidney, and circulates in blood and modulates cardiac function and systemic blood pressure. Lowers blood pressure in vivo by decreasing cardiac contractility and heart rate and preventing a compensatory increase in peripheral vascular tone, suggesting a causal link to the increased plasma catecholamine and heightened cardiovascular risk. High concentrations of catecholamines activate plasma renalase and promotes its secretion and synthesis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...