Suv39h2 (BC032960) Mouse Untagged Clone
CAT#: MC218355
Suv39h2 (untagged) - Mouse suppressor of variegation 3-9 homolog 2 (Drosophila) (cDNA clone MGC:41074 IMAGE:1330053), (10ug)
CNY 6940.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 4930507K23Rik; AA536750; D030054H19Rik; D2Ertd544e; KMT1B |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC032960
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGGCGGCCAGGGCCAAGGCACGGGGCAGTGAGGCAGGAGCGCGGTGTCACCGGGCTCCAGGTCCGC CCCCGAGGCCCAAGGCCAGGCGAACGGCGAGACGCCGCCGCGCGGAGACCCTGACGGCGCGACGCTCGCG GCCGTCTGCGGGCGAGAGGCGCGCCGGCTCCCAGCGAGCGTGGTCCGGAGCTCCGCGGGCCGCGGTCTTT GGCGACGAGTGTGCACGAGGTGCCTTATTCAAGGCCTGGTGTGTGCCTTGCCTAGTTTCACTTGATACTC TCCAGGAATTATGTAGAAAAGAAAAGCTCACATGTAAATCGATTGGAATCACCAAAAGGAATCTAAACAA TTATGAGGTGGAGTACTTGTGTGACTACAAGGTAGCAAAGGTGATCACAAGTGAAGAGGCCGAGAGACGG GGACAGTTCTATGACAACAAAGGGATCACCTACCTCTTTGACCTGGACTACGAGTCTGATGAGTTCACAG TGGATGCAGCTCGATATGGAAACGTATCCCATTTTGTGAATCATAGTTGTGACCCAAATCTTCAGGTGTT TAGTGTTTTCATCGATAACCTTGATACTCGGCTGCCCAGGATAGCATTGTTCTCTACAAGAACCATAAAC GCTGGAGAAGAGCTGACTTTTGACTATCAAATGAAAGGTTCTGGAGAAGCATCTTCAGACTCCATTGACC ACAGCCCTGCCAAAAAAAGGGTCAGAACCCAATGTAAATGTGGAGCCGAGACTTGCAGAGGTTACCTCAA CTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | BC032960 |
| Insert Size | 774 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC032960, AAH32960 |
| RefSeq Size | 1856 bp |
| RefSeq ORF | 773 bp |
| Locus ID | 64707 |
| Gene Summary | Histone methyltransferase that specifically trimethylates 'Lys-9' of histone H3 using monomethylated H3 'Lys-9' as substrate. H3 'Lys-9' trimethylation represents a specific tag for epigenetic transcriptional repression by recruiting HP1 (CBX1, CBX3 and/or CBX5) proteins to methylated histones. Mainly functions in heterochromatin regions, thereby playing a central role in the establishment of constitutive heterochromatin at pericentric and telomere regions. H3 'Lys-9' trimethylation is also required to direct DNA methylation at pericentric repeats. SUV39H1 is targeted to histone H3 via its interaction with RB1 and is involved in many processes, such as cell cycle regulation, transcriptional repression and regulation of telomere length. May participate in regulation of higher-order chromatin organization during spermatogenesis. Recruited by the large PER complex to the E-box elements of the circadian target genes such as PER2 itself or PER1, contributes to the conversion of local chromatin to a heterochromatin-like repressive state through H3 'Lys-9' trimethylation.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG203330 | Suv39h2 (tGFP-tagged) - Mouse suppressor of variegation 3-9 homolog 2 (Drosophila) (cDNA clone MGC:41074 IMAGE:1330053) |
CNY 2850.00 |
|
| MR203330 | Suv39h2 (Myc-DDK-tagged) - Mouse suppressor of variegation 3-9 homolog 2 (Drosophila) (cDNA clone MGC:41074 IMAGE:1330053) |
CNY 2570.00 |
|
| MR203330L3 | Lenti ORF clone of Suv39h2 (Myc-DDK-tagged) - Mouse suppressor of variegation 3-9 homolog 2 (Drosophila) (cDNA clone MGC:41074 IMAGE:1330053) |
CNY 4470.00 |
|
| MR203330L4 | Lenti ORF clone of Suv39h2 (mGFP-tagged) - Mouse suppressor of variegation 3-9 homolog 2 (Drosophila) (cDNA clone MGC:41074 IMAGE:1330053) |
CNY 4470.00 |
其它Suv39h2产品
