Birc3 (BC011338) Mouse Untagged Clone
CAT#: MC218138
Birc3 (untagged) - Mouse baculoviral IAP repeat-containing 3 (cDNA clone MGC:18386 IMAGE:3661563), (10ug)
CNY 6940.00
| Cited in 3 publications. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | IAP1, MIAP1, Birc2, cIAP1, cIAP-1, MIHB, HIAP2, Api2, IAP2, MIHC, MIAP2, RNF49, cIAP2, cIAP-2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC011338
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAACATGGTTCAAGACAGTGCCTTTCTAGCCAAGCTGATGAAGAGTGCTGACACCTTTGAGTTGAAGT ATGACTTTTCCTGTGAGCTGTACCGATTGTCCACATATTCAGCTTTTCCCAGGGGAGTTCCTGTGTCAGA AAGGAGTCTGGCTCGTGCTGGCTTTTACTACACTGGTGTCAATGACAAGGTCAAGTGCTTCTGCTGTGGC CTAATGCTAGACAACTGGAAACAAGGGGGCAGTCCCATGGAGAAGCACAGAAAGTTGTACCCCAGCTGCA ACTTTGTACAGACTTTGAATCCAGCCAACAGTCTGGAAGCTAGTCCTCGGCCTTCTCTTCCTTCCACGGC GATGAGCACCATGCCTTTGAGCTTTGCAAGTTCTGAGAACACTGGCTATTTCAGTGGCTCTTACTCGAGC TTTCCCTCAGACCCTGTGAACTTCCGAGCAAATCAAGATTGTCCTGCTTTGAGCACAAGTCCCTACCACT TTGCAATGAACACAGAGAAGGCCAGATTACTCACCTATGAAACATGGCCATTGTCTTTTCTGTCACCAGC AAAGCTGGCCAAAGCAGGCTTCTACTACATAGGACCTGGAGATAGAGTGGCCTGCTTTGCGTGCGATGGG AAACTGAGCAACTGGGAACGTAAGGATGATGCTATGTCAGAGCACCAGAGGCATTTCCCCAGCTGCCCGT TCTTAAAAGACTTGGGTCAGTCTGCTTCGAGATACACTGTCTCTAACCTGAGCATGCAGACACACGCAGC CCGTATTAGAACATTCTCTAACTGGCCTTCTAGTGCACTAGTTCATTCCCAGGAACTTGCAAGTGCGGGC TTTTATTATACAGGACACAGTGATGATGTCAAGTGTTTTTGCTGTGATGGTGGGCTGAGGTGCTGGGAAT CTGGAGATGACCCCTGGGTGGAACATGCCAAGTGGTTTCCAAGGTGTGAGTACTTGCTCAGAATCAAAGG CCAAGAATTTGTCAGCCAAGTTCAAGCTGGCTATCCTCATCTACTTGAGCAGCTATTATCTACGTCAGAC TCCCCAGAAGATGAGAATGCAGACGCAGCAAGTATGTATAATAATCATAATTCCTGCATTACACTGCTCC GTTTTGCATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | BC011338 |
| Insert Size | 1131 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC011338, AAH11338 |
| RefSeq Size | 2979 bp |
| RefSeq ORF | 1130 bp |
| Locus ID | 11796 |
| Gene Summary | Multi-functional protein which regulates not only caspases and apoptosis, but also modulates inflammatory signaling and immunity, mitogenic kinase signaling and cell proliferation, as well as cell invasion and metastasis. Acts as an E3 ubiquitin-protein ligase regulating NF-kappa-B signaling and regulates both canonical and non-canonical NF-kappa-B signaling by acting in opposite directions: acts as a positive regulator of the canonical pathway and suppresses constitutive activation of non-canonical NF-kappa-B signaling. The target proteins for its E3 ubiquitin-protein ligase activity include: RIPK1, RIPK2, RIPK3, RIPK4, CASP3, CASP7, CASP8, IKBKE, TRAF1, and BCL10. Acts as an important regulator of innate immune signaling via regulation of Toll-like receptors (TLRs), Nodlike receptors (NLRs) and RIG-I like receptors (RLRs), collectively referred to as pattern recognition receptors (PRRs). Protects cells from spontaneous formation of the ripoptosome, a large multi-protein complex that has the capability to kill cancer cells in a caspase-dependent and caspase-independent manner. Suppresses ripoptosome formation by ubiquitinating RIPK1 and CASP8.[UniProtKB/Swiss-Prot Function] |
Citations (3)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
IL-1β induces up-regulation of BIRC3, a gene involved in chemoresistance to doxorubicin in breast cancer cells.
,null,
Cancer letters
,PubMed ID 28093282
[Birc3]
|
|
MERS coronavirus induces apoptosis in kidney and lung by upregulating Smad7 and FGF2
,null,
Nature Microbiology
,PubMed ID 27572168
[Birc3]
|
|
NPD1-mediated stereoselective regulation of BIRC3 expression through cREL is decisive for neural cell survival
,null,
Cell Death and Differentiation
,PubMed ID 25633199
[Birc3]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG205838 | Birc3 (tGFP-tagged) - Mouse baculoviral IAP repeat-containing 3 (cDNA clone MGC:18386 IMAGE:3661563) |
CNY 2380.00 |
|
| MR205838 | Birc3 (Myc-DDK-tagged) - Mouse baculoviral IAP repeat-containing 3 (cDNA clone MGC:18386 IMAGE:3661563) |
CNY 3656.00 |
|
| MR205838L3 | Lenti ORF clone of Birc3 (Myc-DDK-tagged) - Mouse baculoviral IAP repeat-containing 3 (cDNA clone MGC:18386 IMAGE:3661563) |
CNY 4090.00 |
|
| MR205838L4 | Lenti ORF clone of Birc3 (mGFP-tagged) - Mouse baculoviral IAP repeat-containing 3 (cDNA clone MGC:18386 IMAGE:3661563) |
CNY 4090.00 |
