Sfrs7 (BC014857) Mouse Untagged Clone
CAT#: MC217999
Sfrs7 (untagged) - Mouse splicing factor, arginine/serine-rich 7 (cDNA clone MGC:6268 IMAGE:2646366), (10ug)
CNY 6940.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | MGC38287, 9G8, NX-96, 35kDa |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC014857
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCACGCTACGGGCGGTATGGAGGAGAAACCAAGGTATATGTTGGTAACCTGGGAACTGGTGCTGGTA AAGGAGAGTTAGAAAGGGCATTCAGTTACTATGGGCCCTTAAGAACTGTGTGGATTGCCAGAAATCCTCC AGGATTCGCCTTTGTGGAATTTGAAGACCCTAGAGATGCAGAGGATGCAGTTCGAGGATTGGATGGGAAA GTGATTTGTGGTTCTCGAGTGAGGGTTGAACTATCAACAGGCATGCCTCGGAGATCTCGTTTTGATAGGC CACCTGCCCGTCGTCCCTTTGATCCTAATGATAGATGCTATGAGTGTGGTGAAAAGGGACATTATGCTTA TGACTGTCATCGCTATAGCCGACGAAGAAGAAGCAGGTCACGATCTAGATCCCATTCCCGATCCAGGGGA AGGCGATACTCTCGCTCCCGCAGCAGGAGCCGAGGACGGAGGTCAAGATCAGCATCTCCTCGCCGATCAA GGTCTGTGTCTCTTCGTAGATCAAGATCAGCTTCACTCAGAAGATTTAGGTTTGGTTTTATAATAGGATC GAGGTATTTCCAATCCCGCTCAAGGTCGAGATCAAGATCCAGGTTTATTTCACGACCAAGAAGCAGTTGT TCCCCATCAGGAAGTCCCCCCAGAAGTGCAAGTCCAGAAAGAATGGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | BC014857 |
Insert Size | 681 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC014857, AAH14857 |
RefSeq Size | 1045 bp |
RefSeq ORF | 680 bp |
Locus ID | 225027 |
Gene Summary | The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Five transcript variants, four of them protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202659 | Sfrs7 (tGFP-tagged) - Mouse splicing factor, arginine/serine-rich 7 (cDNA clone MGC:6268 IMAGE:2646366) |
CNY 2850.00 |
|
MR202659 | Sfrs7 (Myc-DDK-tagged) - Mouse splicing factor, arginine/serine-rich 7 (cDNA clone MGC:6268 IMAGE:2646366) |
CNY 2400.00 |
|
MR202659L3 | Lenti ORF clone of Sfrs7 (Myc-DDK-tagged) - Mouse splicing factor, arginine/serine-rich 7 (cDNA clone MGC:6268 IMAGE:2646366) |
CNY 4750.00 |
|
MR202659L4 | Lenti ORF clone of Sfrs7 (mGFP-tagged) - Mouse splicing factor, arginine/serine-rich 7 (cDNA clone MGC:6268 IMAGE:2646366) |
CNY 4750.00 |