Vsir (NM_001159572) Mouse Untagged Clone
CAT#: MC217903
4632428N05Rik (untagged) - Mouse RIKEN cDNA 4632428N05 gene (4632428N05Rik), transcript variant 2, (10ug)
CNY 6940.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 4632428N05Rik; Dies1; PD-1H; VISTA |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC217903 ORF sequence
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGTGTCCCCGCGGTCCCAGAGGCCAGCAGCCCGCGCTGGGGAACCCTGCTCCTTGCTATTTTCCTGG CTGCATCCAGAGGTCTGGTAGCAGCCTTCAAGGTCACCACTCCATATTCTCTCTATGTGTGTCCCGAGGG ACAGAATGCCACCCTCACCTGCAGGATTCTGGGCCCCGTGTCCAAAGGGCACGATGTGACCATCTACAAG ACGTGGTACCTCAGCTCACGAGGCGAGGTCCAGATGTGCAAAGAACACCGGCCCATACGCAACTTCACAT TGCAGCACCTTCAGCACCACGGAAGCCACCTGAAAGCCAACGCCAGCCATGACCAGCCCCAGAAGCATGG GCTAGAGCTAGCTTCTGACCACCACGGTAACTTCTCTATCACCCTGCGCAATGTGACCCCAAGGGACAGC GGCCTCTACTGCTGTCTAGTGATAGAATTAAAAAACCACCACCCAGAACAACGGTTCTACGGGTCCATGG AGCTACAGGTACAGGCAGGCAAAGGCTCGGGGTCCACATGCATGGCGTCTAATGAGCAGGACAGTGACAG CATCACGGCTGCGGCCCTGGCCACCGGCGCCTGCATCGTGGGAATCCTCTGCCTCCCCCTTATCCTGCTG CTGGTCTATAAGCAGAGACAGGTGGCCTCTCACCGCCGTGCCCAGGAGTTGGTGAGGATGGACAGCAACA CCCAAGGAATCGAAAACCCAGGCTTCGAGACCACTCCACCCTTCCAGGGGATGCCTGAGGCCAAGACCAG GCCGCCACTGTCCTATGTGGCCCAGCGGCAACCTTCGGAGTCAGGACGGTACCTGCTCTCTGACCCCAGC ACACCTCTGTCGCCTCCAGGCCCTGGGGACGTCTTTTTCCCATCCCTAGATCCAGTCCCTGACTCCCCTA ACTCTGAAGCCATCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001159572 |
| Insert Size | 927 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001159572.1, NP_001153044.1 |
| RefSeq Size | 4843 bp |
| RefSeq ORF | 927 bp |
| Locus ID | 74048 |
| UniProt ID | Q9D659 |
| Gene Summary | Immunoregulatory receptor which inhibits the T-cell response (PubMed:21383057, PubMed:24743150, PubMed:25267631). May promote differentiation of embryonic stem cells, by inhibiting BMP4 signaling (PubMed:20042595). May stimulate MMP14-mediated MMP2 activation (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate splice site in the coding region compared to variant 1. The resulting isoform (2) is shorter but has the same N- and C-termini compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG204370 | 4632428N05Rik (tGFP-tagged) - Mouse RIKEN cDNA 4632428N05 gene (4632428N05Rik) |
CNY 5440.00 |
|
| MR204370 | 4632428N05Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 4632428N05 gene (4632428N05Rik), transcript variant 2 |
CNY 3840.00 |
|
| MR204370L1 | Lenti ORF clone of 4632428N05Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 4632428N05 gene (4632428N05Rik), transcript variant 2 |
CNY 6240.00 |
|
| MR204370L2 | Lenti ORF clone of 4632428N05Rik (mGFP-tagged) - Mouse RIKEN cDNA 4632428N05 gene (4632428N05Rik), transcript variant 2 |
CNY 5890.00 |
|
| MR204370L3 | Lenti ORF clone of 4632428N05Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 4632428N05 gene (4632428N05Rik), transcript variant 2 |
CNY 5890.00 |
|
| MR204370L4 | Lenti ORF clone of 4632428N05Rik (mGFP-tagged) - Mouse RIKEN cDNA 4632428N05 gene (4632428N05Rik), transcript variant 2 |
CNY 5890.00 |
