Neil1 (BC043297) Mouse Untagged Clone
CAT#: MC217894
Neil1 (untagged) - Mouse nei endonuclease VIII-like 1 (E. coli) (cDNA clone MGC:49102 IMAGE:5320651), (10ug)
CNY 6940.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 2810450N13Rik; Nei1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC043297
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCCAGAGGGCCCAGAGCTGCACCTGGCCAGCCACTTTGTGAATGAGACATGTAAGGGGCTGGTATTTG GTGGGTGTGTGGAGAAGTCCTCTGTCAGCCGGAACCCGGAGGTGCCCTTTGAGAGCAGTGCCTACCACAT CTCAGCTTTAGCCCGAGGCAAGGAGCTGCGCTTGACATTGAGCCCCCTGCCTGGGTCCCAGCCCCCTCAG AAGCCACTGTCCCTTGTCTTCCGCTTTGGGATGTCAGGATCCTTCCAGCTGGTACCCGCAGAGGCACTGC CCCGCCACGCCCATCTACGTTTTTACACAGCCCCACCTGCTCCCCGGCTTGCCCTTTGCTTCGTAGACAT CCGTCGCTTTGGCCACTGGGATCCTGGGGGTGAATGGCAACCAGGCCGTGGACCCTGTGTCTTGCTGGAG TATGAACGGTTCAGAGAGAACGTACTTCGGAACCTATCAGACAAAGCCTTTGACCGGCCCATCTGCGAGG CCTTGTTGGACCAGAGGTTCTTCAATGGCATTGGCAACTATCTGCGGGCAGAGATCCTGTACCGGCTGAA GATCCCTCCTTTTGAGAAGGCTCGTACAGTTCTAGAGGCCCTGCAACAGTGCCGGCCGAGCCCAGAGCTG ACCCTGAGCCAGAAGATCAAGGCCAAACTACAGAACCCAGACCTGCTGGAACTGTGTCACTTGGTGCCCA AGGAAGTGGTTCAGCTGGGTGAGGCCTGGGGAGGTCAAGATGGCCGGCGGCCTCTACCTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCTGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | BC043297 |
| Insert Size | 762 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC043297, AAH43297 |
| RefSeq Size | 1857 bp |
| RefSeq ORF | 761 bp |
| Locus ID | 72774 |
| Gene Summary | Involved in base excision repair of DNA damaged by oxidation or by mutagenic agents. Acts as DNA glycosylase that recognizes and removes damaged bases. Has a preference for oxidized pyrimidines, such as thymine glycol, formamidopyrimidine (Fapy) and 5-hydroxyuracil. Has marginal activity towards 8-oxoguanine. Has AP (apurinic/apyrimidinic) lyase activity and introduces nicks in the DNA strand. Cleaves the DNA backbone by beta-delta elimination to generate a single-strand break at the site of the removed base with both 3'- and 5'-phosphates. Has DNA glycosylase/lyase activity towards mismatched uracil and thymine, in particular in U:C and T:C mismatches. Specifically binds 5-hydroxymethylcytosine (5hmC), suggesting that it acts as a specific reader of 5hmC.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG203232 | Neil1 (tGFP-tagged) - Mouse nei endonuclease VIII-like 1 (E. coli) (cDNA clone MGC:49102 IMAGE:5320651) |
CNY 2850.00 |
|
| MR203232 | Neil1 (Myc-DDK-tagged) - Mouse nei endonuclease VIII-like 1 (E. coli) (cDNA clone MGC:49102 IMAGE:5320651) |
CNY 2400.00 |
|
| MR203232L3 | Lenti ORF clone of Neil1 (Myc-DDK-tagged) - Mouse nei endonuclease VIII-like 1 (E. coli) (cDNA clone MGC:49102 IMAGE:5320651) |
CNY 4750.00 |
|
| MR203232L4 | Lenti ORF clone of Neil1 (mGFP-tagged) - Mouse nei endonuclease VIII-like 1 (E. coli) (cDNA clone MGC:49102 IMAGE:5320651) |
CNY 4750.00 |
