Ikzf1 (NM_001025597) Mouse Untagged Clone
CAT#: MC217296
Ikzf1 (untagged) - Mouse IKAROS family zinc finger 1 (Ikzf1), transcript variant 1, (10ug)
CNY 3840.00
CNY 6650.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 5832432G11Rik; hlk-1; I; Ikaros; LyF-; LyF-1; mKIAA4227; Zfpn; Zfpn1a1; Znfn1a1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC217296 representing NM_001025597
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_001025597 |
Insert Size | 1548 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001025597.1, NP_001020768.1 |
RefSeq Size | 5163 bp |
RefSeq ORF | 1548 bp |
Locus ID | 22778 |
Gene Summary | The protein encoded by this gene belongs to a family of transcription factors that are characterized by a set of four DNA-binding zinc fingers at the N-terminus and two C-terminal zinc fingers involved in protein dimerization. It is regulated by both epigenetic and transcription factors. This protein is a transcriptional regulator of hematopoietic cell development and homeostasis. In addition, it is required to confer temporal competence to retinal progenitor cells during embryogenesis, demonstrating an essential function in nervous system development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Both variants 1 and 3 encode the same protein (isoform a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG227516 | Ikzf1 (tGFP-tagged) - Mouse IKAROS family zinc finger 1 (Ikzf1) transcript variant 1, (10ug) |
CNY 5610.00 |
|
MR227516 | Ikzf1 (Myc-DDK-tagged) - Mouse IKAROS family zinc finger 1 (Ikzf1), transcript variant 1 |
CNY 5130.00 |
|
MR227516L3 | Lenti ORF clone of Ikzf1 (Myc-DDK-tagged) - Mouse IKAROS family zinc finger 1 (Ikzf1), transcript variant 1 |
CNY 7030.00 |
|
MR227516L4 | Lenti ORF clone of Ikzf1 (mGFP-tagged) - Mouse IKAROS family zinc finger 1 (Ikzf1), transcript variant 1 |
CNY 7030.00 |