Ikzf1 (NM_001025597) Mouse Untagged Clone

CAT#: MC217296

Ikzf1 (untagged) - Mouse IKAROS family zinc finger 1 (Ikzf1), transcript variant 1, (10ug)



  "NM_001025597" in other vectors (4)

CNY 3840.00

CNY 6650.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Ikzf1 Antibody - N-terminal region
    • 100 ul

CNY 4628.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 5832432G11Rik; hlk-1; I; Ikaros; LyF-; LyF-1; mKIAA4227; Zfpn; Zfpn1a1; Znfn1a1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC217296 representing NM_001025597
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC



ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001025597
Insert Size 1548 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001025597.1, NP_001020768.1
RefSeq Size 5163 bp
RefSeq ORF 1548 bp
Locus ID 22778
Gene Summary The protein encoded by this gene belongs to a family of transcription factors that are characterized by a set of four DNA-binding zinc fingers at the N-terminus and two C-terminal zinc fingers involved in protein dimerization. It is regulated by both epigenetic and transcription factors. This protein is a transcriptional regulator of hematopoietic cell development and homeostasis. In addition, it is required to confer temporal competence to retinal progenitor cells during embryogenesis, demonstrating an essential function in nervous system development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). Both variants 1 and 3 encode the same protein (isoform a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...