Mecp2 (NM_001081979) Mouse Untagged Clone
CAT#: MC216963
Mecp2 (untagged) - Mouse methyl CpG binding protein 2 (Mecp2), transcript variant 1, (10ug)
CNY 3736.00
CNY 6460.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1500041B07Rik; D630021H01Rik; Mbd5; WBP10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC216963 representing NM_001081979
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_001081979 |
Insert Size | 1506 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001081979.1, NP_001075448.1 |
RefSeq Size | 10152 bp |
RefSeq ORF | 1506 bp |
Locus ID | 17257 |
UniProt ID | Q9Z2D6 |
Gene Summary | Chromosomal protein that binds to methylated DNA. It can bind specifically to a single methyl-CpG pair. It is not influenced by sequences flanking the methyl-CpGs. Mediates transcriptional repression through interaction with histone deacetylase and the corepressor SIN3. Binds both 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC)-containing DNA, with a preference for 5-methylcytosine (5mC).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1, also known as alpha) represents the shorter transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226839 | Mecp2 (tGFP-tagged) - Mouse methyl CpG binding protein 2 (Mecp2) transcript variant 1, (10ug) |
CNY 5320.00 |
|
MR226839 | Mecp2 (Myc-DDK-tagged) - Mouse methyl CpG binding protein 2 (Mecp2), transcript variant 1 |
CNY 3728.00 |
|
MR226839L3 | Lenti ORF clone of Mecp2 (Myc-DDK-tagged) - Mouse methyl CpG binding protein 2 (Mecp2), transcript variant 1 |
CNY 6270.00 |
|
MR226839L4 | Lenti ORF clone of Mecp2 (mGFP-tagged) - Mouse methyl CpG binding protein 2 (Mecp2), transcript variant 1 |
CNY 6128.00 |