Mecp2 (NM_001081979) Mouse Untagged Clone

CAT#: MC216963

Mecp2 (untagged) - Mouse methyl CpG binding protein 2 (Mecp2), transcript variant 1, (10ug)



  "NM_001081979" in other vectors (4)

CNY 3736.00

CNY 6460.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-MeCP2 (Ser421) Antibody
    • 100 ul

CNY 5325.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1500041B07Rik; D630021H01Rik; Mbd5; WBP10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216963 representing NM_001081979
Red=Cloning site Blue=ORF Green=Tags(s)

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC



ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAG
GTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001081979
Insert Size 1506 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001081979.1, NP_001075448.1
RefSeq Size 10152 bp
RefSeq ORF 1506 bp
Locus ID 17257
UniProt ID Q9Z2D6
Gene Summary Chromosomal protein that binds to methylated DNA. It can bind specifically to a single methyl-CpG pair. It is not influenced by sequences flanking the methyl-CpGs. Mediates transcriptional repression through interaction with histone deacetylase and the corepressor SIN3. Binds both 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC)-containing DNA, with a preference for 5-methylcytosine (5mC).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1, also known as alpha) represents the shorter transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...