Lyn (NM_010747) Mouse Untagged Clone

CAT#: MC216804

Lyn (untagged) - Mouse Yamaguchi sarcoma viral (v-yes-1) oncogene homolog (Lyn), transcript variant 2, (10ug)



  "NM_010747" in other vectors (4)

CNY 6370.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Lyn Antibody - N-terminal region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AA407514; Hck-2; p53Lyn; p56Lyn
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216804 representing NM_010747
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGGATGTATTAAATCAAAAAGGAAAGACAATCTCAATGACGATGAAGTAGATTCGAAGACTCAACCAG
TTCCTGAATTTCATCTTTTACCAGGACAGAGATTTCAAACAAAAGATCCAGAGGAACAAGGTGACATTGT
GGTGGCCTTATACCCTTATGATGGCATCCACCCAGATGACTTGTCCTTCAAGAAAGGAGAAAAGATGAAA
GTTCTAGAAGAGCATGGGGAATGGTGGAAAGCTAAGTCCCTTTCATCAAAGAGAGAAGGCTTCATCCCCA
GCAACTACGTGGCCAAGGTCAACACCTTAGAAACTGAAGAGTGGTTCTTCAAGGACATAACAAGGAAAGA
TGCAGAGCGACAGCTTCTGGCACCAGGGAACAGTGCAGGAGCTTTCCTTATCAGAGAAAGCGAAACTTTA
AAGGGAAGCTTCTCTCTTTCTGTCAGAGATTATGACCCTATGCATGGTGATGTCATTAAGCACTACAAAA
TTAGAAGTCTGGACAATGGTGGCTATTACATCTCTCCTCGCATCACTTTTCCCTGCATCAGTGACATGAT
TAAGCATTACCAAAAGCAGTCTGATGGTCTATGCAGAAGACTGGAGAAGGCATGCATCAGTCCCAAACCT
CAGAAGCCATGGGATAAAGATGCCTGGGAGATCCCCCGGGAGTCCATTAAGTTGGTGAAAAAGCTTGGCG
CAGGGCAGTTTGGGGAAGTCTGGATGGGTTACTATAACAACAGCACAAAGGTGGCTGTGAAGACCCTCAA
GCCCGGCACCATGTCTGTGCAGGCATTCCTGGAAGAGGCCAACCTCATGAAGACCTTGCAACATGACAAG
CTAGTGCGGCTGTACGCTGTGGTCACCAAGGAGGAGCCCATCTACATCATCACCGAGTTCATGGCTAAGG
GTAGTTTGCTGGATTTCCTCAAGAGTGATGAAGGTGGCAAGGTGCTGCTGCCCAAGCTCATTGACTTCTC
GGCCCAGATTGCAGAAGGCATGGCGTACATCGAGCGGAAGAACTACATCCACCGTGATCTGCGAGCTGCT
AACGTCCTGGTCTCTGAGTCACTCATGTGCAAGATTGCAGACTTTGGCCTCGCGAGAGTCATCGAAGATA
ACGAGTACACAGCAAGGGAAGGTGCGAAGTTCCCTATCAAGTGGACAGCTCCAGAGGCCATCAACTTCGG
CTGCTTCACTATCAAATCTGACGTGTGGTCCTTCGGAATTCTCCTGTATGAGATTGTCACCTATGGGAAG
ATTCCCTACCCAGGGAGAACCAACGCAGATGTGATGAGCGCACTGTCACAGGGATATCGAATGCCACGCA
TGGAGAACTGCCCAGATGAGCTCTATGACATCATGAAAATGTGTTGGAAAGAAAAGGCAGAGGAGAGGCC
AACTTTTGACTACTTACAGAGTGTCCTGGATGACTTCTATACAGCCACAGAAGGGCAGTATCAGCAGCAA
CCGTAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_010747
Insert Size 1476 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_010747.2, NP_034877.2
RefSeq Size 3393 bp
RefSeq ORF 1476 bp
Locus ID 17096
Gene Summary Non-receptor tyrosine-protein kinase that transmits signals from cell surface receptors and plays an important role in the regulation of innate and adaptive immune responses, hematopoiesis, responses to growth factors and cytokines, integrin signaling, but also responses to DNA damage and genotoxic agents. Functions primarily as negative regulator, but can also function as activator, depending on the context. Required for the initiation of the B-cell response, but also for its down-regulation and termination. Plays an important role in the regulation of B-cell differentiation, proliferation, survival and apoptosis, and is important for immune self-tolerance. Acts downstream of several immune receptors, including the B-cell receptor, CD79A, CD79B, CD5, CD19, CD22, FCER1, FCGR2, FCGR1A, TLR2 and TLR4. Plays a role in the inflammatory response to bacterial lipopolysaccharide. Mediates the responses to cytokines and growth factors in hematopoietic progenitors, platelets, erythrocytes, and in mature myeloid cells, such as dendritic cells, neutrophils and eosinophils. Acts downstream of EPOR, KIT, MPL, the chemokine receptor CXCR4, as well as the receptors for IL3, IL5 and CSF2. Plays an important role in integrin signaling. Regulates cell proliferation, survival, differentiation, migration, adhesion, degranulation, and cytokine release. Down-regulates signaling pathways by phosphorylation of immunoreceptor tyrosine-based inhibitory motifs (ITIM), that then serve as binding sites for phosphatases, such as PTPN6/SHP-1, PTPN11/SHP-2 and INPP5D/SHIP-1, that modulate signaling by dephosphorylation of kinases and their substrates. Phosphorylates LIME1 in response to CD22 activation. Phosphorylates BTK, CBL, CD5, CD19, CD72, CD79A, CD79B, CSF2RB, DOK1, HCLS1, LILRB3/PIR-B, MS4A2/FCER1B, SYK and TEC. Promotes phosphorylation of SIRPA, PTPN6/SHP-1, PTPN11/SHP-2 and INPP5D/SHIP-1. Required for rapid phosphorylation of FER in response to FCER1 activation. Mediates KIT phosphorylation. Acts as an effector of EPOR (erythropoietin receptor) in controlling KIT expression and may play a role in erythroid differentiation during the switch between proliferation and maturation. Depending on the context, activates or inhibits several signaling cascades. Regulates phosphatidylinositol 3-kinase activity and AKT1 activation. Regulates activation of the MAP kinase signaling cascade, including activation of MAP2K1/MEK1, MAPK1/ERK2, MAPK3/ERK1, MAPK8/JNK1 and MAPK9/JNK2. Mediates activation of STAT5A and/or STAT5B. Phosphorylates LPXN on 'Tyr-72'. Kinase activity facilitates TLR4-TLR6 heterodimerization and signal initiation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' coding region, compared to variant 1, resulting in a shorter protein (isoform B).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...