Trp63 (NM_001127261) Mouse Untagged Clone

CAT#: MC216651

Trp63 (untagged) - Mouse transformation related protein 63 (Trp63), transcript variant 3, (10ug)



  "NM_001127261" in other vectors (4)

CNY 6270.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (3)
Trp63 Antibody - middle region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AI462811; delta; Ket; p6; p7; p51/p; P51/P63; P63; P73l; TAp; Tp63; Trp5; Trp53rp1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216651 representing NM_001127261
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAATTTTGAAACTTCACGGTGTGCCACCCTACAGTACTGCCCCGACCCTTACATCCAGCGTTTCATAG
AAACCCCAGCTCATTTCTCGTGGAAAGAAAGTTATTACAGATCTGCCATGTCGCAGAGCACCCAGACAAG
CGAGTTCCTCAGCCCAGAGGTCTTCCAGCATATCTGGGATTTTCTGGAACAGCCTATATGCTCAGTACAG
CCCATCGAGTTGAACTTTGTGGATGAACCTTCCGAAAATGGTGCAACAAACAAGATTGAGATTAGCATGG
ATTGTATCCGCATGCAAGACTCAGACCTCAGTGACCCCATGTGGCCACAGTACACGAACCTGGGGCTCCT
GAACAGCATGGACCAGCAGATTCAGAACGGCTCCTCGTCCACCAGCCCCTACAACACAGACCACGCACAG
AATAGCGTGACGGCGCCCTCGCCCTATGCACAGCCCAGCTCCACCTTTGATGCCCTCTCTCCATCCCCTG
CCATTCCCTCCAACACAGATTACCCGGGCCCACACAGCTTCGATGTGTCCTTCCAGCAGTCAAGCACTGC
CAAGTCAGCCACCTGGACGTATTCCACCGAACTGAAGAAGCTGTACTGCCAGATTGCGAAGACATGCCCC
ATCCAGATCAAGGTGATGACCCCACCCCCACAGGGCGCTGTTATCCGTGCCATGCCTGTCTACAAGAAAG
CTGAGCATGTCACCGAGGTTGTGAAACGATGCCCTAACCATGAGCTGAGCCGTGAGTTCAATGAGGGACA
GATTGCCCCTCCCAGTCATCTGATTCGAGTAGAAGGGAACAGCCATGCCCAGTATGTAGAAGATCCTATC
ACGGGAAGGCAGAGCGTGCTGGTCCCTTATGAGCCACCACAGGTTGGCACTGAATTCACAACAGTCCTGT
ACAATTTCATGTGTAACAGCAGCTGCGTCGGAGGAATGAACAGACGTCCAATTTTAATCATCGTTACTCT
GGAAACCAGAGATGGGCAAGTCCTGGGCCGACGGTGCTTTGAGGCCCGGATCTGTGCTTGCCCAGGAAGA
GACCGGAAGGCAGATGAAGACAGCATCAGAAAGCAGCAAGTATCGGACAGCGCAAAGAACGGCGATGCTT
TCCGTCAGAATACACACGGAATCCAGATGACTTCCATCAAGAAACGGAGATCCCCAGATGATGAGCTGCT
GTACCTACCAGTGAGAGGTCGTGAGACGTACGAGATGTTGCTGAAGATCAAAGAGTCACTGGAGCTCATG
CAGTACCTCCCTCAGCACACGATCGAAACGTACAGGCAGCAGCAGCAGCAGCAGCACCAGCACCTACTTC
AGAAACATCTCCTTTCAGCCTGCTTCAGGAATGAGCTTGTGGAGCCCCGGGGAGAAGCTCCGACACAGTC
TGACGTCTTCTTTAGACATTCCAACCCCCCAAACCACTCCGTGTACCCATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001127261
Insert Size 1452 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001127261.1, NP_001120733.1
RefSeq Size 2380 bp
RefSeq ORF 1452 bp
Locus ID 22061
UniProt ID O88898
Gene Summary This gene encodes tumor protein p63, a member of the p53 family of transcription factors involved in cellular responses to stress and development. The family members include tumor proteins p53, p63, and p73, which have high sequence similarity to one another. This similarity allows p63 and p73 to transactivate p53-responsive genes causing cell cycle arrest and apoptosis. The family members can interact with each other in many ways, including direct and indirect protein interactions. This results in mutual regulation of target gene promoters. Tumor protein p63 -/- mice have several developmental defects which include the lack of limbs and other tissues, such as teeth and mammary glands, which develop as a result of interactions between mesenchyme and epithelium. Both alternative splicing and the use of alternative promoters result in multiple transcript variants encoding different protein isoforms.[provided by RefSeq, Dec 2009]
Transcript Variant: This variant (3) lacks an internal 12 nt segment and several 3' exons but has an alternate 3' exon, as compared to variant 1. The resulting isoform (c, also known as TAp63gamma) lacks internal 4 aa and has a shorter and different C-terminus, as compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...