Zfp36l2 (NM_001001806) Mouse Untagged Clone

CAT#: MC216614

Zfp36l2 (untagged) - Mouse zinc finger protein 36, C3H type-like 2 (Zfp36l2), (10ug)



  "NM_001001806" in other vectors (4)

CNY 3656.00

CNY 6270.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-ZFP36L2 Antibody
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Brf2; ERF2; Tis11d
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216614 representing NM_001001806
Red=Cloning site Blue=ORF

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCGACCACACTTCTGTCACCCTTCTACGATATCGACTTCTTGTGCAAGACGGAGAAATCCCTGGCAA
ACCTCAATCTGAACAACATGCTGGACAAGAAGGCGGTAGGGACGCCCGTGGCTGCTGCCCCCAGCTCGAG
CTTCACTCCGGGCTTCCTGCGACGCCACTCCGCCAGCAACCTCCACGCGCTTGCCCACCCTGTGCCCAGT
CCGGGCAGCTGCTCGCCGAAGTTCCCGGGCGCCCCTAACGGCGGCGGCAGCAGCTGTGGCCCCGCAGGCG
GAGGCGGTCTGGCCTCCTACGGCCAGCTCAAGGAGCCTTCGGGGGGCAGCGGCACGGCGCTGGTCACCAA
GGAGAGCAAATTTCGGGACCGCTCGTTCAGCGAGAACGGGGAGCGCAGCCAGCACCTCCTGCACCTGCAG
CAGCAGCAGAAGGGGGGCAGCGGCTCCCAGATCAACTCCACGCGCTACAAGACGGAGCTGTGCCGGCCCT
TCGAGGAGAGCGGCACGTGCAAGTACGGCGAGAAGTGCCAGTTCGCGCACGGCTTCCACGAGCTGCGCAG
CCTCACCCGGCACCCCAAGTACAAGACAGAGCTGTGCCGCACCTTCCACACCATCGGCTTCTGCCCCTAC
GGCCCGCGCTGCCACTTCATCCACAACGCGGACGAGCGGCGGCCCGCGCCGTCGGGGGGCGGCGGCGCCT
CCGGGGACCTGCGAGCGTTTGGCGCACGCGACGCGCTACACCTAGGCTTCGCCCGCGAGCCGCGGCCCAA
GCTGCATCACAGCCTCAGTTTCTCCGGCTTCCCGTCGGGCCACCACCAGCCGCCGGGGGGCCTGGAGTCG
CCGCTGCTGCTCGACAGCCCCACATCGCGCACGCCGCCGCCGCCCTCCTCCTCGGCCTCGTCCTGTTCCT
CCTCGGCTTCTTCCTGCTCTTCCGCCTCGGCGGCCTCCACGCCCTCGGGCGCCCCGACGTGCTGCGCCAC
GGCGGCGGCGGCCGCGCTGCTCTACGGCCCCGGGGGCGCGGAGGACCTGCTGAGCCCCGGAGCGCCGTGC
GCCTCCTGCTCGTCCTCCGGCGCTAACAACGCCTTCGCTTTCGGCCCGGAGCTGAGCAGCCTCATCACGC
CGCTCGCCATCCAGACCCACAACTTCGCCGCCGCGGCCGCCGCCGCCTACTACCGCAACCAGCAGCAGGG
CCTGACCGGTCCCGCGCCACCCCCGGCACAGCCCCCCGCGGCCCCCGCGCCGCCCTCCCCGCCCTTCGGC
TTCCAGCTGCCGCGCCGTCTGTCCGAGTCGCCCGTGTTCGACGCGCCCCCCAGCCCCCCGGACTCGCTCT
CGGACCGCGACAGCTACCTGAGCGGCTCGCTGAGCTCCGGCAGCCTCAGCGGCTCCGAGTCCCCCAGCCT
GGACCCTGGCCGTCGCCTACCCATCTTCAGCCGCCTCTCCATCTCCGACGACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001001806
Insert Size 1455 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC139416, AAI39417
RefSeq Size 2129 bp
RefSeq ORF 1455 bp
Locus ID 12193
UniProt ID P23949
Gene Summary Zinc-finger RNA-binding protein that destabilizes several cytoplasmic AU-rich element (ARE)-containing mRNA transcripts by promoting their poly(A) tail removal or deadenylation, and hence provide a mechanism for attenuating protein synthesis (PubMed:22701344, PubMed:22367205, PubMed:25505318, PubMed:24830504, PubMed:27102483). Acts as a 3'-untranslated region (UTR) ARE mRNA-binding adapter protein to communicate signaling events to the mRNA decay machinery (By similarity). Functions by recruiting the CCR4-NOT deadenylase complex and probably other components of the cytoplasmic RNA decay machinery to the bound ARE-containing mRNAs, and hence promotes ARE-mediated mRNA deadenylation and decay processes (By similarity). Binds to 3' UTR ARE of numerous mRNAs (PubMed:22701344, PubMed:22367205, PubMed:25505318, PubMed:24830504). Promotes ARE-containing mRNA decay of the low-density lipoprotein (LDL) receptor (LDLR) mRNA in response to phorbol 12-myristate 13-acetate (PMA) treatment in a p38 MAPK-dependent manner (By similarity). Positively regulates early adipogenesis by promoting ARE-mediated mRNA decay of immediate early genes (IEGs) (PubMed:22701344). Plays a role in mature peripheral neuron integrity by promoting ARE-containing mRNA decay of the transcriptional repressor REST mRNA (PubMed:25505318). Plays a role in ovulation and oocyte meiotic maturation by promoting ARE-mediated mRNA decay of the luteinizing hormone receptor LHCGR mRNA (PubMed:24830504). Acts as a negative regulator of erythroid cell differentiation: promotes glucocorticoid-induced self-renewal of erythroid cells by binding mRNAs that are induced or highly expressed during terminal erythroid differentiation and promotes their degradation, preventing erythroid cell differentiation (PubMed:19633199, PubMed:23748442). In association with ZFP36L1 maintains quiescence on developing B lymphocytes by promoting ARE-mediated decay of several mRNAs encoding cell cycle regulators that help B cells progress through the cell cycle, and hence ensuring accurate variable-diversity-joining (VDJ) recombination process and functional immune cell formation (PubMed:27102483). Together with ZFP36L1 is also necessary for thymocyte development and prevention of T-cell acute lymphoblastic leukemia (T-ALL) transformation by promoting ARE-mediated mRNA decay of the oncogenic transcription factor NOTCH1 mRNA (PubMed:20622884).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...