Suv39h2 (NM_022724) Mouse Untagged Clone

CAT#: MC216497

Suv39h2 (untagged) - Mouse suppressor of variegation 3-9 homolog 2 (Drosophila) (Suv39h2), transcript variant 1, (10ug)



  "NM_022724" in other vectors (4)

CNY 6180.00


货期*
6周

规格
    • 10 ug

Product images

推荐一起购买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 4930507K23Rik; AA536750; D030054H19Rik; D2Ertd544e; KMT1B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216497 representing NM_022724
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCGGCGGCCAGGGCCAAGGCACGGGGCAGTGAGGCAGGAGCGCGGTGTCACCGGGCTCCAGGTCCGC
CCCCGAGGCCCAAGGCCAGGCGAACGGCGAGACGCCGCCGCGCGGAGACCCTGACGGCGCGACGCTCGCG
GCCGTCTGCGGGCGAGAGGCGCGCCGGCTCCCAGCGAGCGTGGTCCGGAGCTCCGCGGGCCGCGGTCTTT
GGCGACGAGTGTGCACGAGGTGCCTTATTCAAGGCCTGGTGTGTGCCTTGCCTAGTTTCACTTGATACTC
TCCAGGAATTATGTAGAAAAGAAAAGCTCACATGTAAATCGATTGGAATCACCAAAAGGAATCTAAACAA
TTATGAGGTGGAGTACTTGTGTGACTACAAGGTAGCAAAGGGTGTGGAATATTATCTTGTAAAATGGAAA
GGATGGCCAGATTCTACAAACACCTGGGAGCCCTTGAGAAACCTCAGGTGTCCACAGCTCCTGCGGCAGT
TCTCTGATGACAAGAAGACTTACTTAGCTCAGGAAAGGAAATGCAAGGCTGTCAATTCAAAATCCTTGCA
ACCTGCAATTGCTGAGTATATTGTACAGAAAGCTAAGCAAAGAATAGCTCTGCAGAGATGGCAAGATTAC
CTCAACAGAAGAAAGAACCATAAGGGGATGATATTTGTTGAAAACACTGTTGACTTGGAGGGCCCACCTT
TAGACTTCTACTACATTAACGAGTACAGGCCAGCTCCCGGGATCAGCATAAACAGTGAAGCCACCTTTGG
ATGTTCATGTACAGACTGCTTCTTTGACAAGTGTTGTCCTGCTGAAGCTGGAGTTGTGTTGGCTTATAAT
AAGAAGCAACAAATTAAAATCCAACCAGGCACTCCCATCTACGAATGCAACTCAAGGTGTCGATGTGGAC
CTGAATGTCCCAATAGGATTGTACAAAAAGGCACACAATATTCACTGTGCATCTTTAGAACTAGCAATGG
CTGTGGTTGGGGTGTAAAAACCCTTGTGAAGATTAAAAGAATGAGTTTTGTCATGGAATATGTTGGAGAG
GTGATCACAAGTGAAGAGGCCGAGAGACGGGGACAGTTCTATGACAACAAAGGGATCACCTACCTCTTTG
ACCTGGACTACGAGTCTGATGAGTTCACAGTGGATGCAGCTCGATATGGAAACGTATCCCATTTTGTGAA
TCATAGTTGTGACCCAAATCTTCAGGTGTTTAGTGTTTTCATCGATAACCTTGATACTCGGCTGCCCAGG
ATAGCATTGTTCTCTACAAGAACCATAAACGCTGGAGAAGAGCTGACTTTTGACTATCAAATGAAAGGTT
CTGGAGAAGCATCTTCAGACTCCATTGACCACAGCCCTGCCAAAAAAAGGGTCAGAACCCAATGTAAATG
TGGAGCCGAGACTTGCAGAGGTTACCTCAACTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_022724
Insert Size 1434 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_022724.4, NP_073561.2
RefSeq Size 4282 bp
RefSeq ORF 1434 bp
Locus ID 64707
UniProt ID Q9EQQ0
Gene Summary Histone methyltransferase that specifically trimethylates 'Lys-9' of histone H3 using monomethylated H3 'Lys-9' as substrate. H3 'Lys-9' trimethylation represents a specific tag for epigenetic transcriptional repression by recruiting HP1 (CBX1, CBX3 and/or CBX5) proteins to methylated histones. Mainly functions in heterochromatin regions, thereby playing a central role in the establishment of constitutive heterochromatin at pericentric and telomere regions. H3 'Lys-9' trimethylation is also required to direct DNA methylation at pericentric repeats. SUV39H1 is targeted to histone H3 via its interaction with RB1 and is involved in many processes, such as cell cycle regulation, transcriptional repression and regulation of telomere length. May participate in regulation of higher-order chromatin organization during spermatogenesis. Recruited by the large PER complex to the E-box elements of the circadian target genes such as PER2 itself or PER1, contributes to the conversion of local chromatin to a heterochromatin-like repressive state through H3 'Lys-9' trimethylation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longer transcript and encodes the functional protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...