Mef2c (NM_001170537) Mouse Untagged Clone
CAT#: MC216268
Mef2c (untagged) - Mouse myocyte enhancer factor 2C (Mef2c), transcript variant 1, (10ug)
CNY 3,656.00
CNY 6,080.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 5430401D19Rik; 9930028G15Rik; AV011172; Mef2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC216268 representing NM_001170537
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI |
ACCN | NM_001170537 |
Insert Size | 1401 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001170537.1, NP_001164008.1 |
RefSeq Size | 6427 bp |
RefSeq ORF | 1401 bp |
Locus ID | 17260 |
Gene Summary | Transcription activator which binds specifically to the MEF2 element present in the regulatory regions of many muscle-specific genes. Controls cardiac morphogenesis and myogenesis, and is also involved in vascular development. Enhances transcriptional activation mediated by SOX18 (PubMed:11554755). May also be involved in neurogenesis and in the development of cortical architecture. Isoforms that lack the repressor domain are more active than isoform 1 (By similarity). Plays an essential role in hippocampal-dependent learning and memory by suppressing the number of excitatory synapses and thus regulating basal and evoked synaptic transmission. Crucial for normal neuronal development, distribution, and electrical activity in the neocortex. Necessary for proper development of megakaryocytes and platelets and for bone marrow B-lymphopoiesis. Required for B-cell survival and proliferation in response to BCR stimulation, efficient IgG1 antibody responses to T-cell-dependent antigens and for normal induction of germinal center B-cells.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) lacks an alternate in-frame exon in the central coding region, compared to variant 3, resulting in an isoform (1) that is shorter than isoform 3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG226868 | Mef2c (tGFP-tagged) - Mouse myocyte enhancer factor 2C (Mef2c) transcript variant 1, (10ug) |
CNY 3,710.00 |
|
MR226868 | Mef2c (Myc-DDK-tagged) - Mouse myocyte enhancer factor 2C (Mef2c), transcript variant 1 |
CNY 3,330.00 |
|
MR226868L3 | Lenti ORF clone of Mef2c (Myc-DDK-tagged) - Mouse myocyte enhancer factor 2C (Mef2c), transcript variant 1 |
CNY 5,230.00 |
|
MR226868L4 | Lenti ORF clone of Mef2c (mGFP-tagged) - Mouse myocyte enhancer factor 2C (Mef2c), transcript variant 1 |
CNY 5,230.00 |