Esrrb (NM_011934) Mouse Untagged Clone

CAT#: MC216139

Esrrb (untagged) - Mouse estrogen related receptor, beta (Esrrb), transcript variant 1, (10ug)



  "NM_011934" in other vectors (4)

CNY 5990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
ESRRB Antibody - middle region
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Err2; Errb; Estrrb; Nr3b2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC216139 representing NM_011934
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGACGTGTCCGAACTCTGCATCCCGGACCCCCTTGGCTACCACAACCAGCTGCTGAACCGAATGTCGT
CCGAAGACAGGCACCTGGGCTCTAGTTGCGGCTCCTTCATCAAGACGGAGCCATCCAGCCCGTCCTCGGG
CATTGATGCCCTCAGCCACCACAGCCCCAGCGGCTCGTCGGACGCCAGTGGTGGCTTTGGCATTGCCCTG
AGCACCCACGCCAACGGTCTGGACTCGCCGCCTATGTTCGCAGGTGCGGGGCTGGGAGGCAACCCGTGCC
GCAAGAGCTACGAGGACTGTACTAGTGGTATCATGGAGGACTCCGCCATCAAATGCGAGTACATGCTTAA
CGCCATCCCCAAGCGCCTGTGCCTCGTGTGCGGGGACATTGCCTCTGGCTACCACTACGGAGTGGCCTCC
TGCGAGGCTTGCAAGGCGTTCTTCAAGAGAACCATTCAAGGCAACATCGAGTACAACTGCCCGGCCACCA
ATGAATGTGAGATCACCAAACGGAGGCGCAAGTCCTGTCAGGCCTGCCGATTCATGAAATGCCTCAAAGT
GGGGATGCTGAAGGAAGGTGTGCGCCTTGACCGAGTTCGAGGAGGCCGCCAGAAGTACAAGCGACGGCTG
GATTCGGAGAACAGCCCCTACCTGAACCTGCCGATTTCCCCACCTGCTAAAAAGCCATTGACTAAGATCG
TCTCGAATCTACTAGGGGTTGAGCAGGACAAGCTGTATGCTATGCCTCCCAACGATATCCCCGAGGGAGA
TATCAAGGCCCTGACCACTCTCTGTGAATTGGCAGATCGGGAGCTTGTGTTCCTCATCAACTGGGCCAAG
CACATCCCAGGCTTCCCCAGTCTGACACTTGGGGACCAGATGAGCCTGCTGCAGAGTGCCTGGATGGAGA
TTCTCATCTTGGGCATCGTGTACCGCTCGCTCCCATACGATGACAAGCTGGCATACGCCGAGGACTATAT
CATGGATGAGGAACACTCTCGCCTGGTAGGGCTGCTGGACCTTTACCGAGCCATCCTGCAGCTGGTGCGC
AGGTACAAGAAACTCAAGGTAGAGAAGGAAGAGTTTATGATCCTCAAGGCCCTGGCCCTCGCCAACTCAG
ATTCGATGTACATTGAGAACCTGGAGGCGGTGCAGAAGCTCCAGGACCTGCTGCACGAGGCGCTGCAGGA
CTATGAGCTGAGTCAGCGCCACGAGGAGCCGCGGAGGGCCGGCAAGCTGCTGCTGACGCTGCCCCTGCTG
AGGCAGACAGCCGCCAAAGCCGTGCAACACTTCTACAGTGTGAAACTGCAGGGCAAGGTGCCCATGCACA
AACTCTTCCTGGAGATGCTGGAGGCCAAGGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011934
Insert Size 1365 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_011934.4, NP_036064.3
RefSeq Size 4208 bp
RefSeq ORF 1365 bp
Locus ID 26380
UniProt ID Q61539
Gene Summary Transcription factor that binds a canonical ESRRB recognition (ERRE) sequence 5'TCAAGGTCA-3' localized on promoter and enhancer of targets genes regulating their expression or their transcriptional activity (PubMed:27601327, PubMed:23169531, PubMed:23508100, PubMed:26206133, PubMed:20534447, PubMed:18662995, PubMed:18957414, PubMed:27723719, PubMed:23019124). Plays a role, in a LIF-independent manner, in maintainance of self-renewal and pluripotency of embryonic and trophoblast stem cells through different signaling pathways including FGF signaling pathway and Wnt signaling pathways (PubMed:18957414, PubMed:26206133, PubMed:20534447, PubMed:23040478, PubMed:23040477, PubMed:23019124, PubMed:23169531). Upon FGF signaling pathway activation, interacts with KDM1A by directly binding to enhancer site of ELF5 and EOMES and activating their transcription leading to self-renewal of trophoblast stem cells (PubMed:26206133). Also regulates expression of multiple rod-specific genes and is required for survival of this cell type (PubMed:20534447). Plays a role as transcription factor activator of GATA6, NR0B1, POU5F1 and PERM1 (PubMed:18662995, PubMed:23508100, PubMed:18957414). Plays a role as transcription factor repressor of NFE2L2 transcriptional activity and ESR1 transcriptional activity (By similarity). During mitosis remains bound to a subset of interphase target genes, including pluripotency regulators, through the canonical ESRRB recognition (ERRE) sequence, leading to their transcriptional activation in early G1 phase (PubMed:27723719). Can coassemble on structured DNA elements with other transcription factors like SOX2, POU5F1, KDM1A and NCOA3 to trigger ESRRB-dependent gene activation (PubMed:23019124, PubMed:23169531, PubMed:18662995, PubMed:26206133). This mechanism, in the case of SOX2 corecruitment prevents the embryonic stem cells (ESCs) to epiblast stem cells (EpiSC) transition through positive regulation of NR0B1 that inhibits the EpiSC transcriptional program (PubMed:23169531). Also plays a role inner ear development by controlling expression of ion channels and transporters and in early placentation (PubMed:9285590, PubMed:17765677).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the shorter transcript but encodes the longer isoform (1). CCDS Note: An upstream translation start codon is selected for this CCDS for consistency with other family members. The use of an alternative upstream start codon would result in a protein that is 21 aa longer at the N-terminal.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...