Tceal7 (NM_001127169) Mouse Untagged Clone
CAT#: MC215541
Tceal7 (untagged) - Mouse transcription elongation factor A (SII)-like 7 (Tceal7), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110018P05Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC215541 representing NM_001127169
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCAAAAGTCCTGCAATGAAAAAGAAGGAAAGCCCAAGGGCAGTGAGGCAAAGAGGGAGGATGAACAAC CCTGCGGAGCACTTGAAGGCCAGCGACTGGAAGGCAATTTCAGACAGAGGTTGCTTCAGTCTCTTGAAGA ATTTAAAGAAGACATAGACTATAGGCATTTTAAAGGTGAAGAAATGACAGGAGAGGAAGAAGAGATGGAA AGGTGTTTGGAAGAAATAAGAAGTCTGAGAAAAAAATTTAGGGCTCTGCATTCTAACCGTACCCATTCTC GGGACCATCCCTTTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001127169 |
Insert Size | 297 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001127169.1, NP_001120641.1 |
RefSeq Size | 971 bp |
RefSeq ORF | 297 bp |
Locus ID | 100040972 |
UniProt ID | A3KGA4 |
Gene Summary | Plays a role in the negative regulation of NF-kappa-B signaling at the basal level by modulating transcriptional activity of NF-kappa-B on its target gene promoters. Associates with cyclin D1 promoter containing Myc E-box sequence and transcriptionally represses cyclin D1 expression. Regulates telomerase reverse transcriptase expression and telomerase activity in both ALT (alternative lengthening of telomeres)and telomerase-positive cell lines (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG221666 | Tceal7 (tGFP-tagged) - Mouse transcription elongation factor A (SII)-like 7 (Tceal7), (10ug) |
CNY 2850.00 |
|
MR221666 | Tceal7 (Myc-DDK-tagged) - Mouse transcription elongation factor A (SII)-like 7 (Tceal7) |
CNY 1200.00 |
|
MR221666L3 | Lenti ORF clone of Tceal7 (Myc-DDK-tagged) - Mouse transcription elongation factor A (SII)-like 7 (Tceal7) |
CNY 4750.00 |
|
MR221666L4 | Lenti ORF clone of Tceal7 (mGFP-tagged) - Mouse transcription elongation factor A (SII)-like 7 (Tceal7) |
CNY 4750.00 |