Majin (NM_001165919) Mouse Untagged Clone

CAT#: MC215216

1700123I01Rik (untagged) - Mouse RIKEN cDNA 1700123I01 gene (1700123I01Rik), (10ug)



  "NM_001165919" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1700123I01Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC215216 representing NM_001165919
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTTTAAAACCATTCACCTACCCATTTCCAGAGACAAGGTTCCTTCATGCAGGACCCAATGTGTATA
AGTTCAAAATCAGATATGGCAACAGTATCAGAGGAGAAGAAATAGAGGATAAGGAAGTCATCGTCCAGGA
GCTGGAGGATTCTATCCGTGCAGTCTTGGCAAACATGGACAGCCTGCAACCCTTTGTTACAGAACACTTC
ATTGTATTTCCCTATAAAAGCAAGTGGGAGAGAGTTTCCCACCTGAAGTTTAAACATGGGGAAAGCATCC
TGACGCCCTACCCGTTTGTTTTTACTTTGTATATAGAGATGAAATGGTTTGCTGAAGACTTGCCTTCCGG
GAAACCAGCAGATGATATTCCTCTTGAGTTGGTCCTAGCTGAGACGGAAGCAGAAGAAGCCACAATGAGG
AAATGGAAACGGAAACTCATGGAGGAGCCCAGCTCCCCTAGCAGGCAGGGGCCACACAGGGCCAAGATGG
AGACTTCTAGTGAAGCTTCCAGCAACAAGAAGCCTCTGAAGGAGAGCAAGAGGAGCACGGACGAAGAAGC
CCAGCAGGAATATCAGGACACCCCAGCTTCTAATGCCATTGCTGTCAAGGAACAGGATGCTGCGTTGGGG
CATGGCCTGCAAGGGTTGGTTGTCCCTCCACTGCAACATAGCAGTCCACCACCCCCGAAAGAGCCAGGAG
CCAGAGGCTTCTTGGGGTTTCTAAGTGCTCTCTTCCCGTTCCGGTACTTCTTCAAGAAGAGCGGTCAGTG
A


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001165919
Insert Size 771 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001165919.1, NP_001159391.1
RefSeq Size 1613 bp
RefSeq ORF 771 bp
Locus ID 622554
UniProt ID Q9D992
Gene Summary Meiosis-specific telomere-associated protein involved in meiotic telomere attachment to the nucleus inner membrane, a crucial step for homologous pairing and synapsis. Component of the MAJIN-TERB1-TERB2 complex, which promotes telomere cap exchange by mediating attachment of telomeric DNA to the inner nuclear membrane and replacement of the protective cap of telomeric chromosomes: in early meiosis, the MAJIN-TERB1-TERB2 complex associates with telomeric DNA and the shelterin/telosome complex. During prophase, the complex matures and promotes release of the shelterin/telosome complex from telomeric DNA. In the complex, MAJIN acts as the anchoring subunit to the nucleus inner membrane. MAJIN shows DNA-binding activity, possibly for the stabilization of telomere attachment on the nucleus inner membrane.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...