Calhm1 (NM_001081271) Mouse Untagged Clone

CAT#: MC215147

Calhm1 (untagged) - Mouse calcium homeostasis modulator 1 (Calhm1), (10ug)



  "NM_001081271" in other vectors (4)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
EG546729 Antibody - C-terminal region
    • 50 ug

CNY 4628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms EG546729
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC215147 representing NM_001081271
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATAAGTTTCGGATGATCTTCCAGTTCTTGCAATCCAACCAAGAGTCCTTCATGAATGGCATCTGTG
GCATCATGGCGCTGGCCAGTGCGCAGATGTATTCTGCCTTTGACTTCAACTGCCCCTGCTTACCCGGCTA
CAACGTGGTCTACAGCCTGGGCATACTGCTGACGCCTCCCCTGGTGCTCTTCCTGCTTGGTCTGGTCATG
AACAACAACATATCCATGCTAGCTGAAGAGTGGAAGCGCCCCGCAGGTCGCCGGGCCAAGGACCCAGCTG
TTCTACGCTACATGTTCTGTTCCATGGCCCAGAGAGCTCTCATCGCCCCTGTCGTCTGGGTGGCTGTCAC
ACTGCTGGATGGCAAGTGCTTTCTCTGTGCCTTCTGCACAGCTGTGCCCGTGGCCACACTAGGCAATGGC
AGCCTGGTGCCGGGCCTGCCTGCTCCAGAACTTGCTCGCCTACTGGCTCGGGTACCCTGCCCTGAGATCT
ATGATGGGAACTGGCTGCTAGCCCGAGAGGTGGCCGTGCGGTATTTGCGCTGCATCTCTCAGGCACTGGG
TTGGTCCTTCGTGCTGCTGACCACATTACTAGCGTTCGTGGTACGCTCTGTGCGTCCCTGCTTCACGCAG
GTCGCCTTTCTCAAGAGCAAGTACTGGTCCCACTACATTGACATTGAGCGCAAGCTCTTCGATGAGACAT
GCACAGAGCATGCCAAAGCCTTTGCTAAGGTATGTATCCAGCAGTTCTTTGAAGCCATGAACCATGACCT
GGAACTGGGTCATACCCACGGAGTACTGGCCACGGCCACAGCCACAGCCACAGCCACAGAGGCTGTCCAA
AGTCCCTCGGACAGGACAGAAGAAGAGAGGGAGAAGTTGCGTGGCATCACTGACCAAGGCACCATGAATA
GGCTACTCACAAGCTGGCACAAATGCAAACCACCACTGAGGCTGGGCCAGGAGGCACCACTGATGAGCAA
CGGCTGGGCTGGGGGCGAGCCCCGGCCTCCACGCAAGGAAGTGGCCACCTACTTCAGCAAAGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Chromatograms CHROMATOGRAMS
Sequencher program is needed, download here.
Restriction Sites SgfI-MluI     
ACCN NM_001081271
Insert Size 1047 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001081271.1, NP_001074740.1
RefSeq Size 1047 bp
RefSeq ORF 1047 bp
Locus ID 546729
UniProt ID D3Z291
Gene Summary Pore-forming subunit of a voltage-gated ion channel required for sensory perception of sweet, bitter and umami tastes. Specifically present in type II taste bud cells, where it plays a central role in sweet, bitter and umami taste perception by inducing ATP release from the cell, ATP acting as a neurotransmitter to activate afferent neural gustatory pathways. Acts both as a voltage-gated and calcium-activated ion channel: mediates neuronal excitability in response to changes in extracellular Ca(2+) concentration. Has poor ion selectivity and forms a wide pore (around 14 Angstroms) that mediates permeation of Ca(2+), Na(+) and K(+), as well as permeation of monovalent anions. Acts as an activator of the ERK1 and ERK2 cascade. Triggers endoplasmic reticulum stress by reducing the calcium content of the endoplasmic reticulum. May indirectly control amyloid precursor protein (APP) proteolysis and aggregated amyloid-beta (Abeta) peptides levels in a Ca(2+) dependent manner.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...