Minos1 (NM_001163006) Mouse Untagged Clone
CAT#: MC214979
Minos1 (untagged) - Mouse RIKEN cDNA 2310028O11 gene (2310028O11Rik), transcript variant 1, (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2310028O11Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC214979 representing NM_001163006
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCGGAGTCCGAGCTGGGCAGAAAGTGGGACCGGTGCATGGCCGACACGGTCGTGAAGCTAGGTACTG GGTTTGGATTAGGAATTGTTTTCTCCCTCACCTTCTTTAAGAGAAGAATGTGGCCATTAGCCTTTGGTTC TGGCGTGGGATTGGGAATGGCCTACTCCAACTGTCAGCATGACTTTCAGGCTCCGTATCTTCTACATGGA AAATACGTCAAAGAGCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001163006 |
Insert Size | 231 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001163006.2, NP_001156478.1 |
RefSeq Size | 2566 bp |
RefSeq ORF | 231 bp |
Locus ID | 433771 |
UniProt ID | Q7TNS2 |
Gene Summary | Component of the MICOS complex, a large protein complex of the mitochondrial inner membrane that plays crucial roles in the maintenance of crista junctions, inner membrane architecture, and formation of contact sites to the outer membrane.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the shorter transcript but encodes the conserved protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG221740 | Minos1 (tGFP-tagged) - Mouse RIKEN cDNA 2310028O11 gene (2310028O11Rik) transcript variant 1, (10ug) |
CNY 2850.00 |
|
MR221740 | Minos1 (Myc-DDK-tagged) - Mouse RIKEN cDNA 2310028O11 gene (2310028O11Rik), transcript variant 1 |
CNY 1200.00 |
|
MR221740L3 | Lenti ORF clone of Minos1 (Myc-DDK-tagged) - Mouse RIKEN cDNA 2310028O11 gene (2310028O11Rik), transcript variant 1 |
CNY 4750.00 |
|
MR221740L4 | Lenti ORF clone of Minos1 (mGFP-tagged) - Mouse RIKEN cDNA 2310028O11 gene (2310028O11Rik), transcript variant 1 |
CNY 4750.00 |