Nms (NM_001011684) Mouse Untagged Clone
CAT#: MC214960
Nms (untagged) - Mouse neuromedin S (Nms), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AB164466 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC214960 representing NM_001011684
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAACACCCGCTCCCCCACTATTCTCCAATCCTGTTCATCTACTGCTTCTGTATGCTACAGATTCCCT CCTCAGGAGCTTCCCCACCTTTAGCTGATTCTCCCGACGGCTTGGATATTGTGGATCCTGAGCGACTGGC ATACTTTCTGAAGCAGAGGGAAATACATTCTAACCAACCTAAGGAAAACCAGGATGTATACAAAAGGTTT TTATTTCACTACTCCAGAACTCGGAAACCGACACATCCAGTTAGCGCTGAGTTTGCTCCGGTCCATCCAT TGATGCGCCTGGCTGCCAAGCTCGCCAGCAGAAGGATGAAAAGACTGCCGCGATTGCTGCGCCTCGATTC CAGGATGGCTACTGTGGACTTCCCTAAGAAGGATCCTACTACCAGCCTGGGGAGGCCATTTTTCCTTTTC AGGCCTAGGAATGGAAGATACACCGACAACAACTTCCAGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001011684 |
Insert Size | 462 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001011684.2, NP_001011684.3 |
RefSeq Size | 1019 bp |
RefSeq ORF | 462 bp |
Locus ID | 433292 |
UniProt ID | Q5H8A1 |
Gene Summary | This gene encodes a member of the neuromedin family of neuropeptides. The encoded protein is a precursor that is proteolytically processed to generate a biologically active neuropeptide that plays a role in the regulation of circadian rhythm, anorexigenic action, antidiuretic action, cardiovascular function and stimulation of oxytocin and vasopressin release. Mice lacking the encoded neuropeptide exhibit decreased heart rate without any accompanying changes in blood pressure. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate the mature peptide. [provided by RefSeq, Aug 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG224836 | Nms (tGFP-tagged) - Mouse neuromedin S (Nms), (10ug) |
CNY 2850.00 |
|
MR224836 | Nms (Myc-DDK-tagged) - Mouse neuromedin S (Nms) |
CNY 1200.00 |
|
MR224836L3 | Lenti ORF clone of Nms (Myc-DDK-tagged) - Mouse neuromedin S (Nms) |
CNY 4750.00 |
|
MR224836L4 | Lenti ORF clone of Nms (mGFP-tagged) - Mouse neuromedin S (Nms) |
CNY 4750.00 |