Otulin (NM_001013792) Mouse Untagged Clone

CAT#: MC214948

Fam105b (untagged) - Mouse family with sequence similarity 105, member B (Fam105b), (10ug)



  "NM_001013792" in other vectors (4)

CNY 3990.00


货期*
6周

规格
    • 10 ug

Product images

推荐一起购买 (2)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms C79097; Fam105b; m3Sapc; m7-1Sapc
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC214948 representing NM_001013792
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTCGGGGAACCATGCCCCAGCCCGGAGCGTGGCCCGGTGCAAGCTGCGCCGAGACGCCGGCGCGCG
AGGCCGGGGCCGCGGCGCGGGACGGCGGGAAGGTGACGGCCGGCGCGCAGCCCCGGGCCGCGACGCGATG
CCCGGCCGAGCACGAGGAGGACATGTACCGTGCTGCAGATGAAATAGAAAAGGAGAAAGAATTGCTAATA
CATGAAAGAGGGATATCAGAACCCAGGTTAAGTGTGGCTCCTGAAATGGATATCATGGACTACTGCAAAA
AAGAATGGAGAGGAAATACTCAGAAAGCCACATGTATGAAAAAGGGCTATGAGGAAGTGTCTCAGAAATT
CACTTCCATAAGGCGAGTCCGTGGTGATAACTACTGTGCACTGAGGGCCACACTGTTCCAGGCCATGAGC
CAGCTGGCCGAGCTGCCCCCCTGGCTGCAGGACTTGGAGCTCATACTGTTACCAGAGAAGCTGATAAACA
AGTATACCTGGATCAAGCAGTGGAAACTTGGACTGAAATTTGATGGGAAGAGTGAGGACCTGGTTGAAAA
AATTAAGGAATCCCTTGCCCTGCTAAGGAAGAAGTGGGTAAGCCTGGCTGCAATGAAAACTGCTGAAGCG
AGGCAGACAGCTTGTGATGAGCTGTTCACCAACGAAGAGGAGGAGTACAGCCTCTACGAAGCTGTGAAGT
TCCTGATGTTAAACAGAGCCATCGAACTGTACGATGACAAGGAGAAGGGAAAGGAAGTGCCGTTCTTCTC
TGTGCTCTTGTTTGCCCGAGACACATCCAATGACCCTGAACAGCTCCTGAGGAACCACCTAAACCAGGTG
GGACACACGGGGGGCCTTGAGCAGGTTGAGATGTTCCTTCTTGCCTATGCTGTCCGCCACAGCATCCGGG
TGTACCGGCTGTCCAAGTATAACACAGAGGAGTTCATCACAGTCTACCCCACTGATCCCCCCAAGGACTG
GCCAATGGTGACCCTCATAGCTGAGGATGATCGGCACTATAACATCCCTGTCAGAGTGTGTGAGGAGACC
AGTGTGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001013792
Insert Size 1059 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001013792.2, NP_001013814.2
RefSeq Size 1491 bp
RefSeq ORF 1059 bp
Locus ID 432940
UniProt ID Q3UCV8
Gene Summary Deubiquitinase that specifically removes linear ('Met-1'-linked) polyubiquitin chains to substrates and acts as a regulator of angiogenesis and innate immune response (PubMed:23708998, PubMed:27523608, PubMed:29950720). Required during angiogenesis, craniofacial and neuronal development by regulating the canonical Wnt signaling together with the LUBAC complex (PubMed:23708998). Acts as a negative regulator of NF-kappa-B by regulating the activity of the LUBAC complex (By similarity). OTULIN function is mainly restricted to homeostasis of the LUBAC complex: acts by removing 'Met-1'-linked autoubiquitination of the LUBAC complex, thereby preventing inactivation of the LUBAC complex (PubMed:29950720). Acts as a key negative regulator of inflammation by restricting spontaneous inflammation and maintaining immune homeostasis (PubMed:27523608, PubMed:29950720). In myeloid cell, required to prevent unwarranted secretion of cytokines leading to inflammation and autoimmunity by restricting linear polyubiquitin formation (PubMed:27523608). Plays a role in innate immune response by restricting linear polyubiquitin formation on LUBAC complex in response to NOD2 stimulation, probably to limit NOD2-dependent proinflammatory signaling (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...