Tmsb15l (NM_207267) Mouse Untagged Clone
CAT＃: MC214850
Tmsb15l (untagged) - Mouse thymosin beta 15b like (Tmsb15l), (10ug)
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 4930488E11Rik; RP23-389M3.7; Tb15r; Tmsb15b1-Tmsb15b2; Tmsb15r |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC214850 representing NM_207267
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAGCGATAAACCAGACTTGTCAGAAGTTGAAACGTTTGACAAATCAAAGTTGAAGAAAACTAATACTG AAGTAAAAAATACTCTTCCGTCGAATGAAAACAAGATGAGCGATAAACCAGACTTGTCAGAAGTTGAAAC ATTTGACAAAGCAAAGTTGAAGAAAACTAATACTGAAGTAAAAAATACTCTTCCGTCGAAGGAAACTATC CAGCAAGAGAAAGAACACAATGAAAGAACATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_207267 |
| Insert Size | 243 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_207267.4, NP_997150.1 |
| RefSeq Size | 821 bp |
| RefSeq ORF | 243 bp |
| Locus ID | 399591 |
| Gene Summary | This record represents readthrough transcripts derived from two adjacent genes, represented by GeneIDs 100034363 and 666244. Each gene has three exons. The readthrough transcripts include two exons from each gene, such that the second exon is represented twice, although not identically, in the readthrough transcripts. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200142 | Tmsb15l (tGFP-tagged) - Mouse RIKEN cDNA 4930488E11 gene (4930488E11Rik) |
CNY 2850.00 |
|
| MR200142 | Tmsb15l (Myc-DDK-tagged) - Mouse thymosin beta 15b like (Tmsb15l) |
CNY 1320.00 |
|
| MR200142L3 | Lenti ORF clone of Tmsb15l (Myc-DDK-tagged) - Mouse thymosin beta 15b like (Tmsb15l) |
CNY 4750.00 |
|
| MR200142L4 | Lenti ORF clone of Tmsb15l (mGFP-tagged) - Mouse thymosin beta 15b like (Tmsb15l) |
CNY 4750.00 |
其它Tmsb15l产品
