Noto (NM_001007472) Mouse Untagged Clone

CAT#: MC214794

Noto (untagged) - Mouse notochord homolog (Xenopus laevis) (Noto), (10ug)



  "NM_001007472" in other vectors (4)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Flh; MmNot; Not; tc
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC214794 representing NM_001007472
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCAGCCCTGCTCCCTCAGGCACTCAGGTCCAGCCCGGGAGCCTGCGCCCCTGTCCGGGAGCTGTTT
CCCCAGTTGTCCCGCGCCGACTAGCTCGGGGACGCCTGGAGTCATCCTTCTCTGTCGAGGCCATCCTGGC
GAGACCCAAGACCCGAGAGCTGGCGGCCACCTCTCTGCCGCTCTCTACCTGCACCAGTCTGAACCTCCTC
GGTGCGGTGTCGCAGTACGGGGTCCTGCCCTGGGTGTGCTCCACAGGGTCTTGGCTGCCTGCCTACCTGA
GCGTGGGCGTCTACCCGCTGTGCTCCATGTCCTGCGTGCCCGGACTGAATGTCACTCACCACCAGCAGGG
CCTCAGGCTCACAGGATCAGAGCTACCTTACTGTCTAGGCCCTCTGAAATGGGCACCCACCGTGGACCTT
CGGGACCACGGGACCGAGAGACACACAAAGAGGGTTCGCACAACGTTTAACTTGCAGCAGCTGCAAGAGT
TGGAGAAGGTGTTTGCAAAGCAGCACAACCTGGTGGGGAAGGAGAGAGCCCAGCTGGCTGCCAGGCTGCA
CCTGACGGAGAATCAGGTGAGGATCTGGTTCCAAAATCGCAGGGTGAAGTATCAGAAGCAGCAAAAACTG
AAATTGCCTTCCTCCTCTGTCATGGAGGAGCCCTCCAGCAGCTCAGATGGCAACATCCAGAGTGAAGATG
CTGAGTTGGGAATTGGCAGTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001007472
Insert Size 723 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001007472.2, NP_001007473.1
RefSeq Size 1602 bp
RefSeq ORF 723 bp
Locus ID 384452
UniProt ID Q5TIS6
Gene Summary Transcription factor that controls node morphogenesis (PubMed:15231714, PubMed:17884984, PubMed:18061569, PubMed:22357932). Acts downstream of both FOXA2 and Brachyury (T) during notochord development (PubMed:15231714). Is essential for cilia formation in the posterior notochord (PNC) and for left-right patterning; acts upstream of FOXJ1 and RFX3 in this process and is required for the expression of various components important for axonemal assembly and function (PubMed:17884984). Plays a role in regulating axial versus paraxial cell fate (PubMed:18061569). Activates the transcription of ciliary proteins C11orf97 homolog, FAM183B and SPACA9 in the embryonic ventral node (PubMed:27914912).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...