Ifnl3 (NM_177396) Mouse Untagged Clone
CAT#: MC214634
Ifnl3 (untagged) - Mouse interleukin 28B (Il28b), (10ug)
CNY 3600.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | IFL-1; IL-28B; Il28; Il28b; INF-alpha; INF-lambda |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC214634 representing NM_177396
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTCCTCCTGCTGTTGCCTCTGCTGCTGGCCGCAGTGCTGACAAGAACCCAAGCTGACCCTGTCCCCA GGGCCACCAGGCTCCCAGTGGAAGCAAAGGATTGCCACATTGCTCAGTTCAAGTCTCTGTCCCCAAAAGA GCTGCAGGCCTTCAAAAAGGCCAAGGGTGCCATCGAGAAGAGGCTGCTTGAGAAGGACATGAGGTGCAGT TCCCACCTCATCTCCAGGGCCTGGGACCTGAAGCAGCTGCAGGTCCAAGAGCGCCCCAAGGCCTTGCAGG CTGAGGTGGCCCTGACCCTGAAGGTCTGGGAGAACATAAATGACTCAGCCCTGACCACCATCCTGGGCCA GCCTCTTCATACACTGAGCCACATTCACTCCCAGCTGCAGACCTGTACACAGCTTCAGGCCACAGCAGAG CCCAAGCCCCCGAGTCGCCGCCTCTCCCGCTGGCTGCACAGGCTCCAGGAGGCCCAGAGCAAGGAGACTC CTGGCTGCCTGGAGGACTCTGTCACCTCCAACCTGTTTCAACTGCTCCTCCGGGACCTCAAGTGTGTGGC CAGTGGAGACCAGTGTGTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_177396 |
| Insert Size | 582 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_177396.1, NP_796370.1 |
| RefSeq Size | 582 bp |
| RefSeq ORF | 582 bp |
| Locus ID | 338374 |
| UniProt ID | Q8CGK6 |
| Gene Summary | Cytokine with antiviral, antitumour and immunomodulatory activities. Plays a critical role in the antiviral host defense, predominantly in the epithelial tissues. Acts as a ligand for the heterodimeric class II cytokine receptor composed of IL10RB and IFNLR1, and receptor engagement leads to the activation of the JAK/STAT signaling pathway resulting in the expression of IFN-stimulated genes (ISG), which mediate the antiviral state. Has a restricted receptor distribution and therefore restricted targets: is primarily active in epithelial cells and this cell type-selective action is because of the epithelial cell-specific expression of its receptor IFNLR1. Seems not to be essential for early virus-activated host defense in vaginal infection, but plays an important role in Toll-like receptor (TLR)-induced antiviral defense. Plays a significant role in the antiviral immune defense in the intestinal epithelium. Exerts an immunomodulatory effect by up-regulating MHC class I antigen expression.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG221927 | Ifnl3 (tGFP-tagged) - Mouse interleukin 28B (Il28b), (10ug) |
CNY 4370.00 |
|
| MR221927 | Ifnl3 (Myc-DDK-tagged) - Mouse interleukin 28B (Il28b) |
CNY 3600.00 |
|
| MR221927L3 | Lenti ORF clone of Ifnl3 (Myc-DDK-tagged) - Mouse interleukin 28B (Il28b) |
CNY 5890.00 |
|
| MR221927L4 | Lenti ORF clone of Ifnl3 (mGFP-tagged) - Mouse interleukin 28B (Il28b) |
CNY 5890.00 |

