Ifnl2 (NM_001024673) Mouse Untagged Clone
CAT#: MC214588
Ifnl2 (untagged) - Mouse interleukin 28A (Il28a), (10ug)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | EG330496; IL-28A; Il28a |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC214588 representing NM_001024673
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTCCTCCTGCTGTTGCCTCTGCTGCTGGCCGCAGTGCTGACAAGAACCCAAGCTGACCCTGTCCCCA GGGCCACCAGGCTCCCAGTGGAAGCAAAGGATTGCCACATTGCTCAGTTCAAGTCTCTGTCCCCAAAAGA GCTGCAGGCCTTCAAAAAGGCCAAGGATGCCATCGAGAAGAGGCTGCTTGAGAAGGACCTGAGGTGCAGT TCCCACCTCTTCCCCAGGGCCTGGGACCTGAAGCAGCTGCAGGTCCAAGAGCGCCCCAAGGCCTTGCAGG CTGAGGTGGCCCTGACCCTGAAGGTCTGGGAGAACATGACTGACTCAGCCCTGGCCACCATCCTGGGCCA GCCTCTTCATACACTGAGCCACATTCACTCCCAGCTGCAGACCTGTACACAGCTTCAGGCCACAGCAGAG CCCAGGTCCCCGAGCCGCCGCCTCTCCCGCTGGCTGCACAGGCTCCAGGAGGCCCAGAGCAAGGAGACCC CTGGCTGCCTGGAGGCCTCTGTCACCTCCAACCTGTTTCGCCTGCTCACCCGGGACCTCAAGTGTGTGGC CAATGGAGACCAGTGTGTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001024673 |
Insert Size | 582 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001024673.2, NP_001019844.2 |
RefSeq Size | 582 bp |
RefSeq ORF | 582 bp |
Locus ID | 330496 |
UniProt ID | Q4VK74 |
Gene Summary | Cytokine with antiviral, antitumour and immunomodulatory activities. Plays a critical role in the antiviral host defense, predominantly in the epithelial tissues. Acts as a ligand for the heterodimeric class II cytokine receptor composed of IL10RB and IFNLR1, and receptor engagement leads to the activation of the JAK/STAT signaling pathway resulting in the expression of IFN-stimulated genes (ISG), which mediate the antiviral state. Has a restricted receptor distribution and therefore restricted targets: is primarily active in epithelial cells and this cell type-selective action is because of the epithelial cell-specific expression of its receptor IFNLR1. Seems not to be essential for early virus-activated host defense in vaginal infection, but plays an important role in Toll-like receptor (TLR)-induced antiviral defense. Plays a significant role in the antiviral immune defense in the intestinal epithelium. Exerts an immunomodulatory effect by up-regulating MHC class I antigen expression.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG224475 | Ifnl2 (tGFP-tagged) - Mouse interleukin 28A (Il28a), (10ug) |
CNY 2850.00 |
|
MR224475 | Ifnl2 (Myc-DDK-tagged) - Mouse interleukin 28A (Il28a) |
CNY 2400.00 |
|
MR224475L3 | Lenti ORF clone of Ifnl2 (Myc-DDK-tagged) - Mouse interleukin 28A (Il28a) |
CNY 4750.00 |
|
MR224475L4 | Lenti ORF clone of Ifnl2 (mGFP-tagged) - Mouse interleukin 28A (Il28a) |
CNY 4750.00 |